Morpholino

MO1-tnfrsf21

ID

ZDB-MRPHLNO-120302-1

Name

MO1-tnfrsf21

Previous Names

Target

Sequence

5' - TCAAAGACATTTTCCCAGGCATTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tnfrsf21

No data available

Phenotype

Phenotype resulting from MO1-tnfrsf21

Phenotype	Fish	Figures
angiogenesis decreased process quality, abnormal	s843Tg + MO1-tnfrsf21	Fig. 2 from Tam et al., 2012
brain vasculature has fewer parts of type central artery, abnormal	s843Tg + MO1-tnfrsf21	Fig. 3 from Tam et al., 2012
brain vasculature increased permeability, abnormal	s843Tg + MO1-tnfrsf21	Fig. 2 from Tam et al., 2012
central artery decreased branchiness, abnormal	s843Tg + MO1-tnfrsf21	Fig. 2 from Tam et al., 2012
central artery malformed, abnormal	s843Tg + MO1-tnfrsf21	Fig. 3 from Tam et al., 2012
establishment of blood-brain barrier decreased process quality, abnormal	s843Tg + MO1-tnfrsf21	Fig. 2 from Tam et al., 2012
sprouting angiogenesis decreased process quality, abnormal	s843Tg + MO1-tnfrsf21	Fig. 3 from Tam et al., 2012

Phenotype of all Fish created by or utilizing MO1-tnfrsf21

Phenotype	Fish	Conditions	Figures
sprouting angiogenesis decreased process quality, abnormal	s843Tg + MO1-tnfrsf21	standard conditions	Fig. 3 from Tam et al., 2012
central artery malformed, abnormal	s843Tg + MO1-tnfrsf21	standard conditions	Fig. 3 from Tam et al., 2012
establishment of blood-brain barrier decreased process quality, abnormal	s843Tg + MO1-tnfrsf21	standard conditions	Fig. 2 from Tam et al., 2012
brain vasculature increased permeability, abnormal	s843Tg + MO1-tnfrsf21	standard conditions	Fig. 2 from Tam et al., 2012
brain vasculature has fewer parts of type central artery, abnormal	s843Tg + MO1-tnfrsf21	standard conditions	Fig. 3 from Tam et al., 2012
central artery decreased branchiness, abnormal	s843Tg + MO1-tnfrsf21	standard conditions	Fig. 2 from Tam et al., 2012
angiogenesis decreased process quality, abnormal	s843Tg + MO1-tnfrsf21	standard conditions	Fig. 2 from Tam et al., 2012
brain vasculature increased permeability, abnormal	s843Tg + MO1-tnfrsf21 + MO2-tnfrsf19	standard conditions	Fig. 6 from Tam et al., 2012
establishment of blood-brain barrier decreased process quality, abnormal	s843Tg + MO1-tnfrsf21 + MO2-tnfrsf19	standard conditions	Fig. 6 from Tam et al., 2012
sprouting angiogenesis decreased process quality, abnormal	s843Tg + MO1-tnfrsf21 + MO2-tnfrsf19	standard conditions	Fig. 6 from Tam et al., 2012
brain vasculature has fewer parts of type central artery, abnormal	s843Tg + MO1-tnfrsf21 + MO2-tnfrsf19	standard conditions	Fig. 6 from Tam et al., 2012

Citations