Morpholino

MO1-cep41

ID
ZDB-MRPHLNO-120216-4
Name
MO1-cep41
Previous Names
None
Target
Sequence
5' - CATCTTCCAGCAGCAGAGCTTCGGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cep41
Expressed Gene Anatomy Figures
vegfaa Figure 6 with image,  Figure 7 with image from Ki et al., 2019
Phenotype
Phenotype resulting from MO1-cep41
Phenotype Fish Figures
anterior commissure has fewer parts of type anterior commissure axon, abnormal AB + MO1-cep41 Fig. 1 with image from Patowary et al., 2019
blood vessel endothelial cell cilium physical object quality, abnormal s843Tg + MO1-cep41 Figure 3 with image from Ki et al., 2019
brain hydrocephalic, abnormal WT + MO1-cep41 Fig. 2,  Fig. S4 from Lee et al., 2012
caudal commissure has fewer parts of type caudal commissure axon, abnormal AB + MO1-cep41 Fig. 1 with image from Patowary et al., 2019
caudal fin curved, abnormal AB + MO1-cep41 Fig. S1 from Patowary et al., 2019
caudal vein plexus morphology, abnormal s843Tg + MO1-cep41 Figure 2 with image from Ki et al., 2019
cranial neural crest cell cell migration decreased process quality, abnormal AB + MO1-cep41 Fig. 2 with image from Patowary et al., 2019
cranial neural crest cell cell migration delayed, abnormal AB + MO1-cep41 Fig. 2 with image from Patowary et al., 2019
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO1-cep41 Fig. 2 from Lee et al., 2012
dorsal longitudinal anastomotic vessel ruptured, abnormal s843Tg + MO1-cep41 Figure 2 with image,  Figure 4 with image from Ki et al., 2019
endothelial cell vegfaa expression decreased amount, abnormal s843Tg + MO1-cep41 Figure 6 with image from Ki et al., 2019
epithelial cilium movement involved in extracellular fluid movement disrupted, abnormal WT + MO1-cep41 Fig. S12 from Lee et al., 2012
heart edematous, abnormal WT + MO1-cep41 Fig. 2,  Fig. S4 from Lee et al., 2012
heart inverted, abnormal twu34Tg + MO1-cep41 Fig. 2 from Lee et al., 2012
hindbrain migratory cranial neural crest cell mislocalised, abnormal AB + MO1-cep41 Fig. 2 with image from Patowary et al., 2019
inner ear altered number of otolith, abnormal WT + MO1-cep41 Fig. S4 from Lee et al., 2012
intersegmental vessel decreased amount, abnormal s843Tg + MO1-cep41 Figure 2 with image from Ki et al., 2019
intersegmental vessel decreased length, abnormal s843Tg + MO1-cep41 Figure 2 with image from Ki et al., 2019
intersegmental vessel decreased thickness, abnormal s843Tg + MO1-cep41 Figure 2 with image from Ki et al., 2019
intersegmental vessel morphology, abnormal s843Tg + MO1-cep41 Figure 2 with image,  Figure 4 with image from Ki et al., 2019
intersegmental vessel lumen decreased diameter, abnormal s843Tg + MO1-cep41 Figure 2 with image from Ki et al., 2019
Kupffer's vesicle cilium non-functional, abnormal WT + MO1-cep41 Fig. S12 from Lee et al., 2012
migratory cranial neural crest Ab7-sox10 labeling increased distribution, abnormal AB + MO1-cep41 Fig. 2 with image from Patowary et al., 2019
otolith position, abnormal WT + MO1-cep41 Fig. S4 from Lee et al., 2012
pericardium edematous, abnormal AB + MO1-cep41 Fig. S1 from Patowary et al., 2019
post-vent region curved, abnormal WT + MO1-cep41 Fig. 2 from Lee et al., 2012
post-vent region morphology, abnormal WT + MO1-cep41 Fig. S4 from Lee et al., 2012
pronephric duct axonemal microtubule decreased size, abnormal WT + MO1-cep41 Fig. 3,  Fig. S11 from Lee et al., 2012
pronephric duct axonemal microtubule increased amount, abnormal WT + MO1-cep41 Fig. 3,  Fig. S11 from Lee et al., 2012
pronephric duct axoneme morphology, abnormal WT + MO1-cep41 Fig. 3,  Fig. S11 from Lee et al., 2012
rhombomere disorganized, abnormal AB + MO1-cep41 Fig. 1 with image from Patowary et al., 2019
supraoptic tract has fewer parts of type supraoptic tract axon, abnormal AB + MO1-cep41 Fig. 1 with image from Patowary et al., 2019
tubulin-glutamic acid ligase activity disrupted, abnormal s843Tg + MO1-cep41 Figure 3 with image from Ki et al., 2019
Fig. S10 from Lee et al., 2012
white matter morphology, abnormal AB + MO1-cep41 Fig. 1 with image from Patowary et al., 2019
whole organism social behavior process quality, abnormal AB + MO1-cep41 Fig. 3 with image from Patowary et al., 2019
Phenotype of all Fish created by or utilizing MO1-cep41
Phenotype Fish Conditions Figures
cranial neural crest cell cell migration decreased process quality, abnormal AB + MO1-cep41 standard conditions Fig. 2 with image from Patowary et al., 2019
hindbrain migratory cranial neural crest cell mislocalised, abnormal AB + MO1-cep41 standard conditions Fig. 2 with image from Patowary et al., 2019
supraoptic tract has fewer parts of type supraoptic tract axon, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
white matter morphology, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
whole organism social behavior process quality, abnormal AB + MO1-cep41 standard conditions Fig. 3 with image from Patowary et al., 2019
rhombomere disorganized, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
caudal fin curved, abnormal AB + MO1-cep41 control Fig. S1 from Patowary et al., 2019
caudal commissure has fewer parts of type caudal commissure axon, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
pericardium edematous, abnormal AB + MO1-cep41 control Fig. S1 from Patowary et al., 2019
migratory cranial neural crest Ab7-sox10 labeling increased distribution, abnormal AB + MO1-cep41 standard conditions Fig. 2 with image from Patowary et al., 2019
cranial neural crest cell cell migration delayed, abnormal AB + MO1-cep41 standard conditions Fig. 2 with image from Patowary et al., 2019
anterior commissure has fewer parts of type anterior commissure axon, abnormal AB + MO1-cep41 control Fig. 1 with image from Patowary et al., 2019
pronephric duct axonemal microtubule increased amount, abnormal WT + MO1-cep41 standard conditions Fig. 3,  Fig. S11 from Lee et al., 2012
inner ear altered number of otolith, abnormal WT + MO1-cep41 standard conditions Fig. S4 from Lee et al., 2012
pronephric duct axonemal microtubule decreased size, abnormal WT + MO1-cep41 standard conditions Fig. 3,  Fig. S11 from Lee et al., 2012
post-vent region morphology, abnormal WT + MO1-cep41 standard conditions Fig. S4 from Lee et al., 2012
brain hydrocephalic, abnormal WT + MO1-cep41 standard conditions Fig. 2,  Fig. S4 from Lee et al., 2012
otolith position, abnormal WT + MO1-cep41 standard conditions Fig. S4 from Lee et al., 2012
Kupffer's vesicle cilium non-functional, abnormal WT + MO1-cep41 standard conditions Fig. S12 from Lee et al., 2012
heart edematous, abnormal WT + MO1-cep41 standard conditions Fig. 2,  Fig. S4 from Lee et al., 2012
pronephric duct axoneme morphology, abnormal WT + MO1-cep41 standard conditions Fig. 3,  Fig. S11 from Lee et al., 2012
tubulin-glutamic acid ligase activity disrupted, abnormal WT + MO1-cep41 standard conditions Fig. S10 from Lee et al., 2012
epithelial cilium movement involved in extracellular fluid movement disrupted, abnormal WT + MO1-cep41 standard conditions Fig. S12 from Lee et al., 2012
post-vent region curved, abnormal WT + MO1-cep41 standard conditions Fig. 2 from Lee et al., 2012
endothelial cell vegfaa expression amount, ameliorated s843Tg + MO1-cep41 hypoxia Figure 7 with image from Ki et al., 2019
blood vessel endothelial cell cilium physical object quality, abnormal s843Tg + MO1-cep41 control Figure 3 with image from Ki et al., 2019
intersegmental vessel decreased length, abnormal s843Tg + MO1-cep41 control Figure 2 with image from Ki et al., 2019
dorsal longitudinal anastomotic vessel ruptured, abnormal s843Tg + MO1-cep41 control Figure 2 with image,  Figure 4 with image from Ki et al., 2019
intersegmental vessel lumen decreased diameter, abnormal s843Tg + MO1-cep41 control Figure 2 with image from Ki et al., 2019
tubulin-glutamic acid ligase activity disrupted, abnormal s843Tg + MO1-cep41 control Figure 3 with image from Ki et al., 2019
intersegmental vessel decreased amount, abnormal s843Tg + MO1-cep41 control Figure 2 with image from Ki et al., 2019
caudal vein plexus morphology, abnormal s843Tg + MO1-cep41 control Figure 2 with image from Ki et al., 2019
intersegmental vessel morphology, abnormal s843Tg + MO1-cep41 control Figure 2 with image,  Figure 4 with image from Ki et al., 2019
endothelial cell vegfaa expression decreased amount, abnormal s843Tg + MO1-cep41 control Figure 6 with image from Ki et al., 2019
intersegmental vessel decreased thickness, abnormal s843Tg + MO1-cep41 control Figure 2 with image from Ki et al., 2019
heart inverted, abnormal twu34Tg + MO1-cep41 standard conditions Fig. 2 from Lee et al., 2012
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO1-cep41 standard conditions Fig. 2 from Lee et al., 2012
intersegmental vessel morphology, ameliorated s843Tg + MO1-cep41 + MO2-agbl5 control Figure 4 with image from Ki et al., 2019
dorsal longitudinal anastomotic vessel structure, ameliorated s843Tg + MO1-cep41 + MO2-agbl5 control Figure 4 with image from Ki et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.