Morpholino

MO2-grhl2b

ID
ZDB-MRPHLNO-120207-2
Name
MO2-grhl2b
Previous Names
  • ATG-blocking MO (1)
Target
Sequence
5' - TCTTACTGTCTGTCTCCTGTGACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-grhl2b
Expressed Gene Anatomy Figures
en2a Fig. 1 with image,  Fig. 2 with image from Dworkin et al., 2012
gbx1 Fig. 1 with image from Dworkin et al., 2012
her5 Fig. 1 with image from Dworkin et al., 2012
otx2b Fig. 1 with image from Dworkin et al., 2012
pax2a Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Dworkin et al., 2012
wnt1 Fig. 1 with image from Dworkin et al., 2012
Phenotype
Phenotype resulting from MO2-grhl2b
Phenotype Fish Figures
brain apoptotic, abnormal WT + MO2-grhl2b Fig. 2 with image,  Fig. 3 with image from Dworkin et al., 2012
hindbrain apoptotic, abnormal WT + MO2-grhl2b Fig. 1 with image,  Fig. S2 with image from Dworkin et al., 2012
midbrain apoptotic, abnormal WT + MO2-grhl2b Fig. S2 with image from Dworkin et al., 2012
midbrain hindbrain boundary absent, abnormal WT + MO2-grhl2b Fig. 1 with image,  Fig. S2 with image from Dworkin et al., 2012
midbrain hindbrain boundary morphology, abnormal WT + MO2-grhl2b Fig. 2 with image,  Fig. 3 with image from Dworkin et al., 2012
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO2-grhl2b Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. S2 with image from Dworkin et al., 2012
otolith absent, abnormal WT + MO2-grhl2b Fig. S2 with image,  Fig. S3 with image from Dworkin et al., 2012
ventricular system morphology, abnormal WT + MO2-grhl2b Fig. 1 with image,  Fig. S2 with image from Dworkin et al., 2012
ventricular system development disrupted, abnormal WT + MO2-grhl2b Fig. 1 with image,  Fig. S2 with image from Dworkin et al., 2012
Phenotype of all Fish created by or utilizing MO2-grhl2b
Phenotype Fish Conditions Figures
brain apoptotic, abnormal WT + MO2-grhl2b standard conditions Fig. 2 with image,  Fig. 3 with image from Dworkin et al., 2012
midbrain hindbrain boundary absent, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with image,  Fig. S2 with image from Dworkin et al., 2012
otolith absent, abnormal WT + MO2-grhl2b standard conditions Fig. S2 with image,  Fig. S3 with image from Dworkin et al., 2012
ventricular system morphology, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with image,  Fig. S2 with image from Dworkin et al., 2012
midbrain apoptotic, abnormal WT + MO2-grhl2b standard conditions Fig. S2 with image from Dworkin et al., 2012
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. S2 with image from Dworkin et al., 2012
ventricular system development disrupted, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with image,  Fig. S2 with image from Dworkin et al., 2012
midbrain hindbrain boundary morphology, abnormal WT + MO2-grhl2b standard conditions Fig. 2 with image,  Fig. 3 with image from Dworkin et al., 2012
hindbrain apoptotic, abnormal WT + MO2-grhl2b standard conditions Fig. 1 with image,  Fig. S2 with image from Dworkin et al., 2012
brain apoptotic, abnormal tp53zdf1/zdf1 + MO2-grhl2b standard conditions Fig. 2 with image from Dworkin et al., 2012
midbrain-hindbrain boundary morphogenesis disrupted, abnormal tp53zdf1/zdf1 + MO2-grhl2b standard conditions Fig. 2 with image from Dworkin et al., 2012
midbrain hindbrain boundary morphology, abnormal tp53zdf1/zdf1 + MO2-grhl2b standard conditions Fig. 2 with image from Dworkin et al., 2012
midbrain hindbrain boundary neural tube morphology, exacerbated TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
somite shape, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
post-vent region agenesis, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
notochord increased width, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
convergent extension involved in axis elongation disrupted, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
midbrain-hindbrain boundary morphogenesis disrupted, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
whole organism anterior-posterior axis decreased length, exacerbated TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
brain apoptotic, abnormal WT + MO1-en2a + MO2-grhl2b standard conditions Fig. 3 with image from Dworkin et al., 2012
midbrain-hindbrain boundary morphogenesis disrupted, abnormal WT + MO2-cdc42se1 + MO2-grhl2b standard conditions Fig. 5 with image from Dworkin et al., 2012
ventricular system development disrupted, abnormal WT + MO2-cdc42se1 + MO2-grhl2b standard conditions Fig. 5 with image from Dworkin et al., 2012
midbrain hindbrain boundary morphology, abnormal WT + MO2-cdc42se1 + MO2-grhl2b standard conditions Fig. 5 with image from Dworkin et al., 2012
trunk shortened, abnormal WT + MO2-grhl2a + MO2-grhl2b standard conditions Fig. S6 with image from Dworkin et al., 2012
notochord undulate, abnormal WT + MO2-grhl2a + MO2-grhl2b standard conditions Fig. S6 with image from Dworkin et al., 2012
post-vent region deformed, abnormal WT + MO2-grhl2a + MO2-grhl2b standard conditions Fig. S6 with image from Dworkin et al., 2012
midbrain hindbrain boundary morphology, abnormal WT + MO2-grhl2a + MO2-grhl2b standard conditions Fig. S6 with image from Dworkin et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.