Morpholino

MO1-irf8

ID
ZDB-MRPHLNO-111212-2
Name
MO1-irf8
Previous Names
  • irf8 MOsp (1)
Target
Sequence
5' - AATGTTTCGCTTACTTTGAAAATGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-irf8
Expressed Gene Anatomy Figures
apoeb Fig. 2 from Li et al., 2011
csf1ra Fig. 2 from Li et al., 2011
eef1a1l1 Fig. 6 from Li et al., 2011
il1b Fig. 6 with image from Shiau et al., 2013
il12a Fig. 6 with image from Shiau et al., 2013
irg1l Fig. 2 from Hall et al., 2014
lcp1 Fig. 4 from Li et al., 2011
lyz Fig. 3 from Li et al., 2011
mfap4.1 Fig. 6 with image from Shiau et al., 2013
mpx Fig. 3 from Li et al., 2011
spi1b Fig. 6 from Li et al., 2011
tnfa Fig. 6 with image from Shiau et al., 2013
Phenotype
Phenotype resulting from MO1-irf8
Phenotype Fish Figures
defense response to fungus process quality, abnormal WT + MO1-irf8 Fig. 5 from Knox et al., 2014
macrophage absent, abnormal WT + MO1-irf8 Fig. 2 from Li et al., 2011
macrophage aplastic, abnormal uwm12Tg + MO1-irf8 Fig. S2 from Knox et al., 2014
macrophage decreased amount, abnormal nz50Tg + MO1-irf8 Fig. 5 with image from Pagán et al., 2015
Fig. S1 with image from Yan et al., 2015
Fig. S2 from Knox et al., 2014
Fig. S4 with image from Feng et al., 2012
Fig. 2 from Li et al., 2011
microglial cell decreased amount, abnormal WT + MO1-irf8 Fig. 2 from Li et al., 2011
neutrophil increased amount, abnormal i113Tg + MO1-irf8 Fig. S1 with image from Yan et al., 2015
Fig. S4 with image from Feng et al., 2012
Fig. 3,  Fig. 4 from Li et al., 2011
whole organism decreased life span, abnormal WT + MO1-irf8 Fig. 5 from Knox et al., 2014
whole organism lacks all parts of type macrophage, abnormal WT + MO1-irf8 Fig. 6 with image from Shiau et al., 2013
Phenotype of all Fish created by or utilizing MO1-irf8
Phenotype Fish Conditions Figures
whole organism decreased life span, exacerbated AB + MO1-irf8 bacterial treatment by injection: Streptococcus iniae Fig. 5 with image from Vincent et al., 2017
whole organism decreased life span, exacerbated AB/TL + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 4 from Masud et al., 2019
whole organism has extra parts of type neutrophil, abnormal TU + MO1-irf8 bacterial treatment by injection: Acinetobacter baumannii ATCC 17978 Fig. S2 with image from Bhuiyan et al., 2016
whole organism has fewer parts of type macrophage, abnormal TU + MO1-irf8 bacterial treatment by injection: Acinetobacter baumannii ATCC 17978 Fig. S2 with image from Bhuiyan et al., 2016
head epidermis irg1l expression position, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
caudal fin regenerating fin il1b expression increased amount, abnormal WT + MO1-irf8 amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
epithelial cell irg1l expression position, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
trunk acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
defense response to fungus process quality, abnormal WT + MO1-irf8 standard conditions Fig. 5 from Knox et al., 2014
microglial cell decreased amount, abnormal WT + MO1-irf8 standard conditions Fig. 2 from Li et al., 2011
macrophage absent, abnormal WT + MO1-irf8 standard conditions Fig. 2 from Li et al., 2011
vasculature acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
regenerating fin apoptotic process occurrence, ameliorated WT + MO1-irf8 chemical treatment by environment: dexamethasone, amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
neuromast epithelium irg1l expression position, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
macrophage decreased amount, abnormal WT + MO1-irf8 standard conditions Fig. 2 from Li et al., 2011
olfactory epithelium irg1l expression position, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 from Hall et al., 2014
blood cebpb expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 2 with image from Hall et al., 2013
neutrophil increased amount, abnormal WT + MO1-irf8 standard conditions Fig. 3,  Fig. 4 from Li et al., 2011
whole organism lacks all parts of type macrophage, abnormal WT + MO1-irf8 standard conditions Fig. 6 with image from Shiau et al., 2013
fin regeneration increased duration, abnormal WT + MO1-irf8 physical alteration: anatomical structure Fig. 5 from Li et al., 2012
macrophage decreased amount, abnormal WT + MO1-irf8 amputation: caudal fin Fig. 4 with image from Hasegawa et al., 2017
whole organism decreased life span, abnormal WT + MO1-irf8 standard conditions Fig. 5 from Knox et al., 2014
hindbrain acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
regenerating fin apoptotic process increased occurrence, abnormal WT + MO1-irf8 amputation: caudal fin Fig. 4 with image,  Fig. 5 with image from Hasegawa et al., 2017
midbrain acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
macrophage acod1 expression amount, ameliorated WT + MO1-irf8 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 1 with image from Hall et al., 2013
macrophage decreased amount, abnormal gl22Tg + MO1-irf8 standard conditions Fig. S1 with image from Yan et al., 2015
neutrophil increased amount, abnormal i113Tg + MO1-irf8 standard conditions Fig. 4 from Li et al., 2011
macrophage decreased amount, abnormal i113Tg + MO1-irf8 standard conditions Fig. 2 from Li et al., 2011
macrophage decreased amount, abnormal nz50Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil increased amount, abnormal nz50Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. S4 with image from Feng et al., 2012
neutrophil increased amount, abnormal nz50Tg + MO1-irf8 standard conditions Fig. S1 with image from Yan et al., 2015
Fig. S4 with image from Feng et al., 2012
macrophage decreased amount, abnormal nz50Tg + MO1-irf8 standard conditions Fig. S4 with image from Feng et al., 2012
trunk vasculature morphology, ameliorated s843Tg + MO1-irf8 bacterial treatment by injection: Mycobacterium marinum M Fig. 3 with image from Torraca et al., 2017
trunk vasculature response to bacterium process quality, abnormal s843Tg + MO1-irf8 bacterial treatment by injection: Mycobacterium marinum M Fig. 3 with image from Torraca et al., 2017
myelin accumulating cell cell projection amount, ameliorated ue2Tg + MO1-irf8 (AB) bacterial treatment by injection: Mycobacterium leprae, chemical treatment by injection: clondronate(2-), chemical ablation: macrophage Fig. 5 with image from Madigan et al., 2017
neuron myelin sheath disorganized, ameliorated ue2Tg + MO1-irf8 (AB) bacterial treatment by injection: Mycobacterium leprae, chemical treatment by injection: clondronate(2-), chemical ablation: macrophage Fig. 5 with image from Madigan et al., 2017
macrophage decreased amount, abnormal uwm12Tg + MO1-irf8 standard conditions Fig. S2 from Knox et al., 2014
defense response to fungus process quality, abnormal uwm12Tg + MO1-irf8 fungal treatment: Aspergillus fumigatus Fig. 2 from Knox et al., 2014
macrophage aplastic, abnormal uwm12Tg + MO1-irf8 standard conditions Fig. S2 from Knox et al., 2014
whole organism decreased life span, abnormal uwm12Tg + MO1-irf8 fungal treatment: Aspergillus fumigatus Fig. 2 from Knox et al., 2014
whole organism decreased life span, exacerbated uwm12Tg + MO1-irf8 bacterial treatment by injection: Streptococcus iniae Fig. 1 with image from Vincent et al., 2017
macrophage decreased amount, abnormal w200Tg + MO1-irf8 control Fig. 5 with image from Pagán et al., 2015
macrophage absent, abnormal uwm12Tg; uwm24Tg + MO1-irf8 physical alteration: caudal fin Fig. 2 from Tauzin et al., 2014
neutrophil response to wounding process quality, abnormal uwm12Tg; uwm24Tg + MO1-irf8 physical alteration: caudal fin Fig. 2 from Tauzin et al., 2014
neutrophil chemotaxis process quality, abnormal uwm12Tg; uwm24Tg + MO1-irf8 physical alteration: caudal fin Fig. 2 from Tauzin et al., 2014
whole organism lacks all parts of type macrophage, abnormal nlrc3lst73/+ + MO1-irf8 standard conditions Fig. 6 with image from Shiau et al., 2013
whole organism lacks all parts of type macrophage, abnormal nlrc3lst73/st73 + MO1-irf8 standard conditions Fig. 6 with image from Shiau et al., 2013
regenerating fin apoptotic process occurrence, ameliorated WT + MO1-il1b + MO1-irf8 amputation: caudal fin Fig. 5 with image from Hasegawa et al., 2017
neutrophil decreased amount, ameliorated nz50Tg + MO1-irf8 + MO3-septin15 bacterial treatment by injection: Shigella flexneri Fig. 3 with image from Mazon-Moya et al., 2017
whole organism decreased life span, abnormal nz50Tg + MO1-irf8 + MO3-septin15 bacterial treatment by injection: Shigella flexneri Fig. 3 with image from Mazon-Moya et al., 2017
whole organism decreased life span, exacerbated uwm36Tg + MO1-irf8 bacterial treatment by injection: Streptococcus iniae Fig. 5 with image from Vincent et al., 2017
muscle cell cell wall repair process quality, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
macrophage absent, abnormal gl22Tg + MO1-irf8 + MO1-spi1b + MO3-csf3r light damage: sarcolemma: muscle cell Fig. 1 with image from Middel et al., 2016
trunk vasculature morphology, ameliorated cxcr4bt26035/t26035; s843Tg + MO1-irf8 bacterial treatment by injection: Mycobacterium marinum M Fig. 3 with image from Torraca et al., 2017
trunk vasculature response to bacterium process quality, abnormal cxcr4bt26035/t26035; s843Tg + MO1-irf8 bacterial treatment by injection: Mycobacterium marinum M Fig. 3 with image from Torraca et al., 2017
liver increased size, abnormal gz32Tg; nz50Tg + MO1-irf8 chemical treatment: doxycycline monohydrate Fig. 3 with image from Yan et al., 2015
liver neutrophil increased amount, abnormal gz32Tg; nz50Tg + MO1-irf8 chemical treatment: doxycycline monohydrate Fig. 3 with image from Yan et al., 2015
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
macrophage decreased amount, abnormal hzm1Et; io006Tg + MO1-irf8 standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell decreased amount, abnormal hzm1Et; io006Tg + MO1-irf8 standard conditions Fig. 3 with image from Feng et al., 2012
neutrophil increased amount, abnormal hzm1Et; io006Tg + MO1-irf8 standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-irf8 standard conditions Fig. 3 with image from Feng et al., 2012
mucus secreting cell proliferative, abnormal hzm1Et; io006Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
neutrophil increased amount, abnormal hzm1Et; io006Tg + MO1-irf8 chemical treatment: prostaglandin E2 Fig. 3 with image from Feng et al., 2012
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-irf8 control Fig. 3 with image from Antonio et al., 2015
macrophage absent, abnormal hzm1Et; io006Tg; nz50Tg + MO1-irf8 resection: caudal fin Fig. 3 with image from Antonio et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.