Morpholino

MO1-rbfox1l

ID

ZDB-MRPHLNO-111205-1

Name

MO1-rbfox1l

Previous Names

None

Target

rbfox1l (1)

Sequence

5' - GCATTTGTTTTACCCCAAACATCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rbfox1l

No data available

Phenotype

Phenotype resulting from MO1-rbfox1l

Phenotype	Fish	Figures
skeletal muscle decreased force, abnormal	AB + MO1-rbfox1l	Fig. 6 from Martin et al., 2015
skeletal muscle contraction decreased efficacy, abnormal	AB + MO1-rbfox1l	Fig. 6 from Martin et al., 2015

Phenotype of all Fish created by or utilizing MO1-rbfox1l

Phenotype	Fish	Conditions	Figures
skeletal muscle decreased force, abnormal	AB + MO1-rbfox1l	control	Fig. 6 from Martin et al., 2015
skeletal muscle contraction decreased efficacy, abnormal	AB + MO1-rbfox1l	control	Fig. 6 from Martin et al., 2015
whole organism decreased coiling, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	text only from Gallagher et al., 2011
skeletal muscle transverse plane structure, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	control	Fig. 5 from Martin et al., 2015
myofibril assembly disrupted, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 6 from Gallagher et al., 2011
muscle myofibril undulate, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. S9 from Gallagher et al., 2011
locomotory behavior decreased occurrence, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	text only from Gallagher et al., 2011
whole organism paralysed, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	text only from Gallagher et al., 2011
skeletal muscle paralysed, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	control	Fig. 6 from Martin et al., 2015
muscle striated muscle thin filament disorganized, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 5 from Gallagher et al., 2011
skeletal muscle contraction decreased efficacy, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	control	Fig. 6 from Martin et al., 2015
skeletal muscle contraction decreased occurrence, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	control	Fig. 6 from Martin et al., 2015
muscle sarcomere decreased amount, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 6 from Gallagher et al., 2011
muscle myofibril disorganized, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 5 , Fig. S9 from Gallagher et al., 2011
muscle sarcomere disorganized, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 6 from Gallagher et al., 2011
muscle Z disc misaligned with muscle Z disc, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 6 from Gallagher et al., 2011
skeletal muscle decreased force, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	control	Fig. 6 from Martin et al., 2015
thigmotaxis disrupted, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	text only from Gallagher et al., 2011
skeletal muscle transverse plane shape, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	control	Fig. 5 from Martin et al., 2015
muscle sarcoplasmic reticulum disorganized, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 6 from Gallagher et al., 2011
muscle refractivity, abnormal	AB + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 4 from Gallagher et al., 2011
heart morphology, abnormal	f1Tg + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 4 from Gallagher et al., 2011
myocardium non-functional, abnormal	f1Tg + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 4 from Gallagher et al., 2011
ventricular cardiac muscle tissue morphogenesis disrupted, abnormal	f1Tg + MO1-rbfox1l + MO1-rbfox2	standard conditions	Fig. 4 from Gallagher et al., 2011

Citations