Morpholino

MO2-npnta

ID
ZDB-MRPHLNO-111018-2
Name
MO2-npnta
Previous Names
  • MO2-npnt
Target
Sequence
5' - TGTGAAACGGCAGACGGAACTCACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-npnta
Phenotype
Phenotype resulting from MO2-npnta
Phenotype Fish Figures
atrioventricular canal cardiac muscle cell increased amount, abnormal f2Tg; s883Tg + MO2-npnta Fig. 4 with image from Patra et al., 2011
atrioventricular canal endocardium increased length, abnormal s843Tg + MO2-npnta Fig. 6 with image from Patra et al., 2011
atrioventricular valve increased length, abnormal WT + MO2-npnta Fig. 4 with image from Patra et al., 2011
atrioventricular valve morphology, abnormal s883Tg + MO2-npnta Fig. 2 with imageFig. 3 with image from Patra et al., 2011
atrioventricular valve morphogenesis disrupted, abnormal WT + MO2-npnta Fig. 2 with image from Patra et al., 2011
cardiac jelly increased volume, abnormal WT + MO2-npnta Fig. 2 with imageFig. 5 with image from Patra et al., 2011
cardiac jelly mislocalised, abnormal WT + MO2-npnta Fig. 2 with imageFig. 5 with image from Patra et al., 2011
endocardium far from myocardium, abnormal WT + MO2-npnta Fig. 5 with image from Patra et al., 2011
eye vascular plexus EGFP expression absent, abnormal lri500Tg + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
glomerular basement membrane increased width, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
glomerular basement membrane morphology, abnormal WT + MO2-npnta Fig. 5 from Müller-Deile et al., 2021
glomerular basement membrane wrinkled, abnormal WT + MO2-npnta Fig. 5 from Müller-Deile et al., 2021
glomerular filtration disrupted, abnormal lri500Tg + MO2-npnta Fig. 2 from Müller-Deile et al., 2017
heart straight, abnormal s883Tg + MO2-npnta Fig. 3 with image from Patra et al., 2011
heart trabecula formation disrupted, abnormal s883Tg + MO2-npnta Fig. 2 with image from Patra et al., 2011
lamina densa increased width, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
lamina rara interna increased width, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
lamina rara interna structure, cavities, abnormal WT + MO2-npnta Fig. 3 from Müller-Deile et al., 2017
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO2-npnta Fig. 2 from Müller-Deile et al., 2017
pericardium edematous, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
Fig. 2 from Müller-Deile et al., 2017
Fig. 2 with image from Patra et al., 2011
podocyte decreased thickness, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
podocyte microvillus increased length, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
pronephric podocyte podocyte foot flattened, abnormal WT + MO2-npnta Fig. 3 from Müller-Deile et al., 2017
trabecular layer morphology, abnormal WT + MO2-npnta Fig. 2 with image from Patra et al., 2011
whole organism dead, abnormal WT + MO2-npnta Fig. 2 with image from Patra et al., 2011
whole organism npnta expression decreased amount, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
yolk syncytial layer edematous, abnormal WT + MO2-npnta Fig. 4 from Müller-Deile et al., 2021
Fig. 2 from Müller-Deile et al., 2017
Phenotype of all Fish created by or utilizing MO2-npnta
Phenotype Fish Conditions Figures
cardiac jelly mislocalised, abnormal WT + MO2-npnta standard conditions Fig. 2 with imageFig. 5 with image from Patra et al., 2011
podocyte microvillus increased length, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
podocyte decreased thickness, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
cardiac jelly increased volume, abnormal WT + MO2-npnta standard conditions Fig. 2 with imageFig. 5 with image from Patra et al., 2011
endocardium far from myocardium, abnormal WT + MO2-npnta standard conditions Fig. 5 with image from Patra et al., 2011
pericardium edematous, abnormal WT + MO2-npnta standard conditions Fig. 4 from Müller-Deile et al., 2021
Fig. 2 from Müller-Deile et al., 2017
Fig. 2 with image from Patra et al., 2011
atrioventricular valve morphogenesis disrupted, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
heart trabecula formation disrupted, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
whole organism dead, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
glomerular basement membrane increased permeability, abnormal WT + MO2-npnta chemical treatment by injection: gold nanoparticle Fig. 6 from Müller-Deile et al., 2021
pronephric podocyte podocyte foot flattened, abnormal WT + MO2-npnta standard conditions Fig. 3 from Müller-Deile et al., 2017
lamina rara interna increased width, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
glomerular basement membrane increased width, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
podocyte increased permeability, abnormal WT + MO2-npnta chemical treatment by injection: gold nanoparticle Fig. 6 from Müller-Deile et al., 2021
lamina densa increased width, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
trabecular layer morphology, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
glomerular basement membrane wrinkled, abnormal WT + MO2-npnta control Fig. 5 from Müller-Deile et al., 2021
pronephric glomerulus glomerular filtration decreased process quality, abnormal WT + MO2-npnta chemical treatment by injection: gold nanoparticle Fig. 6 from Müller-Deile et al., 2021
atrioventricular valve increased length, abnormal WT + MO2-npnta standard conditions Fig. 4 with image from Patra et al., 2011
glomerular basement membrane morphology, abnormal WT + MO2-npnta control Fig. 5 from Müller-Deile et al., 2021
yolk syncytial layer edematous, abnormal WT + MO2-npnta standard conditions Fig. 4 from Müller-Deile et al., 2021
Fig. 2 from Müller-Deile et al., 2017
lamina rara interna structure, cavities, abnormal WT + MO2-npnta standard conditions Fig. 3 from Müller-Deile et al., 2017
whole organism npnta expression decreased amount, abnormal WT + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
atrioventricular valve morphology, abnormal WT + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
urine protein increased amount, abnormal WT + MO2-npnta chemical treatment by injection: dextran Fig. 2 from Müller-Deile et al., 2017
atrioventricular valve morphology, abnormal f2Tg + MO2-npnta standard conditions Fig. 3 with image from Patra et al., 2011
eye vascular plexus EGFP expression absent, abnormal lri500Tg + MO2-npnta control Fig. 4 from Müller-Deile et al., 2021
optic choroid vascular plexus EGFP expression decreased amount, abnormal lri500Tg + MO2-npnta standard conditions Fig. 2 from Müller-Deile et al., 2017
glomerular filtration disrupted, abnormal lri500Tg + MO2-npnta standard conditions Fig. 2 from Müller-Deile et al., 2017
atrioventricular canal endocardium increased length, abnormal s843Tg + MO2-npnta standard conditions Fig. 6 with image from Patra et al., 2011
atrioventricular valve morphology, abnormal s883Tg + MO2-npnta standard conditions Fig. 3 with image from Patra et al., 2011
heart straight, abnormal s883Tg + MO2-npnta standard conditions Fig. 3 with image from Patra et al., 2011
trabecular layer morphology, abnormal s883Tg + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
heart trabecula formation disrupted, abnormal s883Tg + MO2-npnta standard conditions Fig. 2 with image from Patra et al., 2011
atrioventricular valve increased length, abnormal f2Tg; s883Tg + MO2-npnta standard conditions Fig. 4 with image from Patra et al., 2011
atrioventricular canal cardiac muscle cell increased amount, abnormal f2Tg; s883Tg + MO2-npnta standard conditions Fig. 4 with image from Patra et al., 2011
cardiac jelly decreased volume, abnormal WT + MO1-has2 + MO2-npnta standard conditions Fig. 5 with image from Patra et al., 2011
atrioventricular canal endocardium decreased length, abnormal s843Tg + MO1-has2 + MO2-npnta standard conditions Fig. 6 with image from Patra et al., 2011
Citations