Morpholino

MO1-wdr18

ID

ZDB-MRPHLNO-110921-1

Name

MO1-wdr18

Previous Names

wdr18-I1E2-MO1 (1)

Target

wdr18 (1)

Sequence

5' - TGTAGCTGGTCCTGAAAAGAAGTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-wdr18

Expressed Gene	Anatomy	Figures
pitx2	lateral plate mesoderm left side	Fig. 3 from Gao et al., 2011
sox17	forerunner cell group	Fig. 6 from Gao et al., 2011
spaw	lateral plate mesoderm right side	Fig. 3 from Gao et al., 2011

Phenotype

Phenotype resulting from MO1-wdr18

Phenotype	Fish	Figures
determination of heart left/right asymmetry disrupted, abnormal	AB + MO1-wdr18	Fig. 2 from Gao et al., 2011
determination of left/right symmetry disrupted, abnormal	AB + MO1-wdr18	Fig. 2 from Gao et al., 2011
forerunner cell group mislocalised, abnormal	AB + MO1-wdr18	Fig. 6 from Gao et al., 2011
Kupffer's vesicle decreased functionality, abnormal	AB + MO1-wdr18	Fig. 5 from Gao et al., 2011
Kupffer's vesicle decreased size, abnormal	AB + MO1-wdr18	Fig. 4 from Gao et al., 2011
Kupffer's vesicle bicellular tight junction disorganized, abnormal	AB + MO1-wdr18	Fig. 4 from Gao et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal	AB + MO1-wdr18	Fig. 4 from Gao et al., 2011
Kupffer's vesicle cilium decreased length, abnormal	AB + MO1-wdr18	Fig. 4 from Gao et al., 2011
Kupffer's vesicle development disrupted, abnormal	AB + MO1-wdr18	Fig. 4 , Fig. 6 from Gao et al., 2011
left/right axis specification disrupted, abnormal	AB + MO1-wdr18	Fig. 3 from Gao et al., 2011
pancreas mislocalised, abnormal	AB + MO1-wdr18	Fig. 2 from Gao et al., 2011

Phenotype of all Fish created by or utilizing MO1-wdr18

Phenotype	Fish	Conditions	Figures
Kupffer's vesicle cilium decreased length, abnormal	AB + MO1-wdr18	standard conditions	Fig. 4 from Gao et al., 2011
Kupffer's vesicle development disrupted, abnormal	AB + MO1-wdr18	standard conditions	Fig. 4 , Fig. 6 from Gao et al., 2011
determination of heart left/right asymmetry disrupted, abnormal	AB + MO1-wdr18	standard conditions	Fig. 2 from Gao et al., 2011
Kupffer's vesicle decreased functionality, abnormal	AB + MO1-wdr18	standard conditions	Fig. 5 from Gao et al., 2011
forerunner cell group mislocalised, abnormal	AB + MO1-wdr18	standard conditions	Fig. 6 from Gao et al., 2011
left/right axis specification disrupted, abnormal	AB + MO1-wdr18	standard conditions	Fig. 3 from Gao et al., 2011
pancreas mislocalised, abnormal	AB + MO1-wdr18	standard conditions	Fig. 2 from Gao et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal	AB + MO1-wdr18	standard conditions	Fig. 4 from Gao et al., 2011
determination of left/right symmetry disrupted, abnormal	AB + MO1-wdr18	standard conditions	Fig. 2 from Gao et al., 2011
Kupffer's vesicle bicellular tight junction disorganized, abnormal	AB + MO1-wdr18	standard conditions	Fig. 4 from Gao et al., 2011
Kupffer's vesicle decreased size, abnormal	AB + MO1-wdr18	standard conditions	Fig. 4 from Gao et al., 2011
forerunner cell group mislocalised, abnormal	AB + MO1-wdr18 + MO3-itgb1b	standard conditions	Fig. 7 from Gao et al., 2011
determination of left/right symmetry disrupted, abnormal	AB + MO1-wdr18 + MO3-itgb1b	standard conditions	Fig. 7 from Gao et al., 2011

Citations