Morpholino

MO5-lmna

ID
ZDB-MRPHLNO-110601-2
Name
MO5-lmna
Previous Names
  • zLMNA-MO1 (1)
Target
Sequence
5' - CATGGTTGTCTGGAACTACTGATA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-lmna
Expressed Gene Anatomy Figures
ccnd1 Fig. 5 with image from Koshimizu et al., 2011
ccne1 Fig. 5 with image from Koshimizu et al., 2011
cdk2 Fig. 5 with image from Koshimizu et al., 2011
cdkn1a Fig. 5 with image from Koshimizu et al., 2011
pcna Fig. S5 with image from Koshimizu et al., 2011
pparg Fig. S6 with image from Koshimizu et al., 2011
tp53 Fig. 5 with image from Koshimizu et al., 2011
Phenotype
Phenotype resulting from MO5-lmna
Phenotype Fish Figures
brain apoptotic, abnormal WT + MO5-lmna Fig. 5 with image from Koshimizu et al., 2011
ceratohyal cartilage mislocalised posteriorly, abnormal WT + MO5-lmna Fig. 4 with image from Koshimizu et al., 2011
fat cell decreased amount, abnormal WT + MO5-lmna Fig. S6 with image from Koshimizu et al., 2011
fat cell differentiation decreased occurrence, abnormal WT + MO5-lmna Fig. S6 with image from Koshimizu et al., 2011
Meckel's cartilage alignment palatoquadrate cartilage, abnormal WT + MO5-lmna Fig. 4 with image from Koshimizu et al., 2011
mitotic M phase duration, abnormal WT + MO5-lmna Fig. 5 with image from Koshimizu et al., 2011
mitotic S phase duration, abnormal WT + MO5-lmna Fig. 5 with image from Koshimizu et al., 2011
myotome slow muscle cell decreased amount, abnormal WT + MO5-lmna Fig. 4 with image from Koshimizu et al., 2011
trunk apoptotic, abnormal WT + MO5-lmna Fig. 5 with image from Koshimizu et al., 2011
Phenotype of all Fish created by or utilizing MO5-lmna
Phenotype Fish Conditions Figures
mitotic S phase duration, abnormal WT + MO5-lmna standard conditions Fig. 5 with image from Koshimizu et al., 2011
brain apoptotic, abnormal WT + MO5-lmna standard conditions Fig. 5 with image from Koshimizu et al., 2011
myotome slow muscle cell decreased amount, abnormal WT + MO5-lmna standard conditions Fig. 4 with image from Koshimizu et al., 2011
ceratohyal cartilage mislocalised posteriorly, abnormal WT + MO5-lmna standard conditions Fig. 4 with image from Koshimizu et al., 2011
fat cell differentiation decreased occurrence, abnormal WT + MO5-lmna standard conditions Fig. S6 with image from Koshimizu et al., 2011
mitotic M phase duration, abnormal WT + MO5-lmna standard conditions Fig. 5 with image from Koshimizu et al., 2011
trunk apoptotic, abnormal WT + MO5-lmna standard conditions Fig. 5 with image from Koshimizu et al., 2011
Meckel's cartilage alignment palatoquadrate cartilage, abnormal WT + MO5-lmna standard conditions Fig. 4 with image from Koshimizu et al., 2011
fat cell decreased amount, abnormal WT + MO5-lmna standard conditions Fig. S6 with image from Koshimizu et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.