Morpholino

MO2-noto

ID

ZDB-MRPHLNO-110304-4

Name

MO2-noto

Previous Names

MO2-flh

Target

noto (1)

Sequence

5' - GTAAGCTCTTCCGGGAATCTGCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-noto

Expressed Gene	Anatomy	Figures
col2a1a	floor plate hypochord	Fig. 8 from Dal-Pra et al., 2011
foxa2	hypoblast	Fig. S5 from Dal-Pra et al., 2011
foxa3	hypoblast	Fig. S5 from Dal-Pra et al., 2011
im:7144261	notochord	Fig. 8 from Dal-Pra et al., 2011
myf5	presumptive paraxial mesoderm	Fig. 8 , Fig. S5 from Dal-Pra et al., 2011
noto	shield	Fig. 8 from Dal-Pra et al., 2011
twist2	axial chorda mesoderm	Fig. 8 , Fig. S5 from Dal-Pra et al., 2011

Phenotype

Phenotype resulting from MO2-noto

Phenotype	Fish	Figures
axial chorda mesoderm decreased width, abnormal	WT + MO2-noto	Fig. 8 , Fig. S5 from Dal-Pra et al., 2011
floor plate disorganized, abnormal	WT + MO2-noto	Fig. 8 , Fig. S5 from Dal-Pra et al., 2011
hypochord aplastic, abnormal	WT + MO2-noto	Fig. S5 from Dal-Pra et al., 2011
hypochord disorganized, abnormal	WT + MO2-noto	Fig. 8 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO2-noto	Fig. S5 from Dal-Pra et al., 2011
notochord disorganized, abnormal	WT + MO2-noto	Fig. 8 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO2-noto	Fig. 8 , Fig. S5 from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal	WT + MO2-noto	Fig. S5 from Dal-Pra et al., 2011
somite fused with somite, abnormal	WT + MO2-noto	Fig. S5 from Dal-Pra et al., 2011

Phenotype of all Fish created by or utilizing MO2-noto

Phenotype	Fish	Conditions	Figures
floor plate disorganized, abnormal	WT + MO2-noto	standard conditions	Fig. 8 , Fig. S5 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO2-noto	standard conditions	Fig. S5 from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal	WT + MO2-noto	standard conditions	Fig. S5 from Dal-Pra et al., 2011
somite fused with somite, abnormal	WT + MO2-noto	standard conditions	Fig. S5 from Dal-Pra et al., 2011
hypochord disorganized, abnormal	WT + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO2-noto	standard conditions	Fig. 8 , Fig. S5 from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal	WT + MO2-noto	standard conditions	Fig. 8 , Fig. S5 from Dal-Pra et al., 2011
hypochord aplastic, abnormal	WT + MO2-noto	standard conditions	Fig. S5 from Dal-Pra et al., 2011
notochord disorganized, abnormal	WT + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
hypochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
floor plate aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011

Citations