Morpholino

MO1-cobl

ID
ZDB-MRPHLNO-110218-2
Name
MO1-cobl
Previous Names
  • cobl-MOa (1)
Target
Sequence
5' - CCTGGGCCTTCATTCTCCTCCTGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO that straddles the intron 1 - exon 2 boundary (splice acceptor site), resulting in either the splicing out of coding exon 2, use of a cryptic splice site in exon 2, or the retention of intron 1. ( ZDB-PUB-101209-18 )
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cobl
Expressed Gene Anatomy Figures
cobl Fig. 3 with image from Ravanelli et al., 2011
pitx2 Fig. 4 with image from Ravanelli et al., 2011
spaw Fig. 4 with image from Ravanelli et al., 2011
Phenotype
Phenotype resulting from MO1-cobl
Phenotype Fish Figures
ciliated epithelial cell apical cortex composition, abnormal EKW + MO1-cobl Fig. 6 with image from Ravanelli et al., 2011
ciliated epithelial cell filamentous actin decreased mass, abnormal EKW + MO1-cobl Fig. 6 with image from Ravanelli et al., 2011
cilium assembly process quality, abnormal EKW + MO1-cobl Fig. 5 with image from Ravanelli et al., 2011
determination of left/right asymmetry in lateral mesoderm process quality, abnormal EKW + MO1-cobl Fig. 4 with image from Ravanelli et al., 2011
head decreased size, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
heart jogging process quality, abnormal f1Tg + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
heart tube bilateral symmetry, abnormal f1Tg + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
Kupffer's vesicle ciliated epithelial cell physical object quality, abnormal EKW + MO1-cobl Fig. 6 with image from Ravanelli et al., 2011
Kupffer's vesicle motile cilium decreased length, abnormal EKW + MO1-cobl Fig. 5 with image from Ravanelli et al., 2011
post-vent region curled, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
pronephric duct motile cilium decreased length, abnormal EKW + MO1-cobl Fig. 5 with image from Ravanelli et al., 2011
pronephric duct motile cilium direction, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
pronephric glomerulus cystic, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
pronephric proximal convoluted tubule increased diameter, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
pronephric tubule increased diameter, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
trunk curved ventral, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
Phenotype of all Fish created by or utilizing MO1-cobl
Phenotype Fish Conditions Figures
post-vent region curled, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
pronephric glomerulus cystic, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
pronephric proximal convoluted tubule increased diameter, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
pronephric tubule increased diameter, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
head decreased size, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
cilium assembly process quality, abnormal EKW + MO1-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
determination of left/right asymmetry in lateral mesoderm process quality, abnormal EKW + MO1-cobl standard conditions Fig. 4 with image from Ravanelli et al., 2011
trunk curved ventral, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
ciliated epithelial cell filamentous actin decreased mass, abnormal EKW + MO1-cobl standard conditions Fig. 6 with image from Ravanelli et al., 2011
Kupffer's vesicle ciliated epithelial cell physical object quality, abnormal EKW + MO1-cobl standard conditions Fig. 6 with image from Ravanelli et al., 2011
pronephric duct motile cilium direction, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
ciliated epithelial cell apical cortex composition, abnormal EKW + MO1-cobl standard conditions Fig. 6 with image from Ravanelli et al., 2011
pronephric duct motile cilium decreased length, abnormal EKW + MO1-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
Kupffer's vesicle motile cilium decreased length, abnormal EKW + MO1-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
Kupffer's vesicle motile cilium decreased length, abnormal EKW + MO1-cobl + MO2-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
cilium assembly process quality, abnormal EKW + MO1-cobl + MO2-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
heart jogging process quality, abnormal f1Tg + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
heart tube bilateral symmetry, abnormal f1Tg + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
heart tube bilateral symmetry, abnormal f1Tg + MO1-cobl + MO2-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
heart jogging process quality, abnormal f1Tg + MO1-cobl + MO2-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.