Morpholino

MO2-rock2b

ID
ZDB-MRPHLNO-110119-4
Name
MO2-rock2b
Previous Names
None
Target
Sequence
5' - CATTGCGGCAGCTCGGTGTCCTTAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rock2b
Expressed Gene Anatomy Figures
foxa3 Fig. 3 with image from Wang et al., 2011
myl7 Fig. 3 with image from Wang et al., 2011
shha Fig. 4 with image from Wang et al., 2011
spaw Fig. 4 with image from Wang et al., 2011
Phenotype
Phenotype resulting from MO2-rock2b
Phenotype Fish Figures
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB + MO2-rock2b Fig. 4 with image from Wang et al., 2011
determination of liver left/right asymmetry disrupted, abnormal AB + MO2-rock2b Fig. 3 with image from Wang et al., 2011
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO2-rock2b Fig. 3 with image from Wang et al., 2011
heart looping disrupted, abnormal AB + MO2-rock2b Fig. 3 with image from Wang et al., 2011
heart tube centered, abnormal AB + MO2-rock2b Fig. 3 with image from Wang et al., 2011
heart tube inverted, abnormal AB + MO2-rock2b Fig. 3 with image from Wang et al., 2011
Kupffer's vesicle decreased functionality, abnormal AB + MO2-rock2b Fig. 6 with image from Wang et al., 2011
Kupffer's vesicle cilium spatial pattern, abnormal AB + MO2-rock2b Fig. 5 with image from Wang et al., 2011
Kupffer's vesicle cilium symmetry, abnormal AB + MO2-rock2b Fig. 5 with image from Wang et al., 2011
Kupffer's vesicle portion of organism substance circling direction, abnormal AB + MO2-rock2b Fig. 6 with image from Wang et al., 2011
Kupffer's vesicle portion of organism substance decreased fluid flow, abnormal AB + MO2-rock2b Fig. 6 with image from Wang et al., 2011
lateral plate mesoderm bilateral symmetry, abnormal AB + MO2-rock2b Fig. 4 with image from Wang et al., 2011
lateral plate mesoderm symmetry, abnormal AB + MO2-rock2b Fig. 4 with image from Wang et al., 2011
liver inverted, abnormal AB + MO2-rock2b Fig. 3 with image from Wang et al., 2011
liver symmetry, abnormal AB + MO2-rock2b Fig. 3 with image from Wang et al., 2011
pancreas inverted, abnormal AB + MO2-rock2b Fig. 3 with image from Wang et al., 2011
pancreas symmetry, abnormal AB + MO2-rock2b Fig. 3 with image from Wang et al., 2011
Phenotype of all Fish created by or utilizing MO2-rock2b
Phenotype Fish Conditions Figures
liver symmetry, abnormal AB + MO2-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
Kupffer's vesicle portion of organism substance circling direction, abnormal AB + MO2-rock2b standard conditions Fig. 6 with image from Wang et al., 2011
heart tube inverted, abnormal AB + MO2-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO2-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
Kupffer's vesicle portion of organism substance decreased fluid flow, abnormal AB + MO2-rock2b standard conditions Fig. 6 with image from Wang et al., 2011
determination of liver left/right asymmetry disrupted, abnormal AB + MO2-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
heart looping disrupted, abnormal AB + MO2-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
heart tube centered, abnormal AB + MO2-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
Kupffer's vesicle cilium symmetry, abnormal AB + MO2-rock2b standard conditions Fig. 5 with image from Wang et al., 2011
Kupffer's vesicle decreased functionality, abnormal AB + MO2-rock2b standard conditions Fig. 6 with image from Wang et al., 2011
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal AB + MO2-rock2b standard conditions Fig. 4 with image from Wang et al., 2011
Kupffer's vesicle cilium spatial pattern, abnormal AB + MO2-rock2b standard conditions Fig. 5 with image from Wang et al., 2011
lateral plate mesoderm bilateral symmetry, abnormal AB + MO2-rock2b standard conditions Fig. 4 with image from Wang et al., 2011
pancreas inverted, abnormal AB + MO2-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
pancreas symmetry, abnormal AB + MO2-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
lateral plate mesoderm symmetry, abnormal AB + MO2-rock2b standard conditions Fig. 4 with image from Wang et al., 2011
liver inverted, abnormal AB + MO2-rock2b standard conditions Fig. 3 with image from Wang et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.