Morpholino

MO4-grna

ID

ZDB-MRPHLNO-101119-2

Name

MO4-grna

Previous Names

None

Target

grna (1)

Sequence

5' - GAGCAGGTGGATTTGTGAACAGCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-grna

Expressed Gene	Anatomy	Figures
grna	whole organism	Fig. 3 from Chitramuthu et al., 2010
grnb	whole organism	Fig. 3 from Chitramuthu et al., 2010
isl1a	cranial ganglion hypothalamus pharyngeal arch retinal ganglion cell layer	Fig. 4 from Chitramuthu et al., 2010

Phenotype

Phenotype resulting from MO4-grna

Phenotype	Fish	Figures
axon extension process quality, abnormal	ml2Tg + MO4-grna	Fig. 1 , Fig. 2 from Chitramuthu et al., 2017 Fig. 5 from Chitramuthu et al., 2010
CaP motoneuron axon decreased length, abnormal	WT + MO4-grna	Fig. 1 , Fig. 2 , Fig. 5 from Chitramuthu et al., 2017 Fig. 5 from Chitramuthu et al., 2010
myotome acetylcholine-gated channel complex disorganized, abnormal	ml2Tg + MO4-grna	Fig. 2 from Chitramuthu et al., 2017
myotome acetylcholine-gated channel complex mislocalised, abnormal	ml2Tg + MO4-grna	Fig. 2 from Chitramuthu et al., 2017
nervous system development process quality, abnormal	WT + MO4-grna	Fig. 4 from Chitramuthu et al., 2010
skeletal muscle acetylcholine-gated channel clustering process quality, abnormal	ml2Tg + MO4-grna	Fig. 2 from Chitramuthu et al., 2017
somite border shape, abnormal	ml2Tg + MO4-grna	Fig. 2 from Chitramuthu et al., 2017
spinal cord decreased length, abnormal	ml2Tg + MO4-grna	Fig. 2 from Chitramuthu et al., 2017
thigmotaxis decreased process quality, abnormal	ml2Tg + MO4-grna	Fig. 1 , Fig. 2 , Fig. 5 from Chitramuthu et al., 2017
whole organism anterior-posterior axis decreased length, abnormal	ml2Tg + MO4-grna	Fig. 2 from Chitramuthu et al., 2017

Phenotype of all Fish created by or utilizing MO4-grna

Phenotype	Fish	Conditions	Figures
nervous system development process quality, abnormal	WT + MO4-grna	standard conditions	Fig. 4 from Chitramuthu et al., 2010
CaP motoneuron axon decreased length, abnormal	WT + MO4-grna	standard conditions	Fig. 5 from Chitramuthu et al., 2010
axon extension process quality, abnormal	WT + MO4-grna	standard conditions	Fig. 5 from Chitramuthu et al., 2010
myotome acetylcholine-gated channel complex mislocalised, abnormal	ml2Tg + MO4-grna	standard conditions	Fig. 2 from Chitramuthu et al., 2017
whole organism anterior-posterior axis decreased length, abnormal	ml2Tg + MO4-grna	standard conditions	Fig. 2 from Chitramuthu et al., 2017
axon extension process quality, abnormal	ml2Tg + MO4-grna	standard conditions	Fig. 1 , Fig. 2 from Chitramuthu et al., 2017
skeletal muscle acetylcholine-gated channel clustering process quality, abnormal	ml2Tg + MO4-grna	standard conditions	Fig. 2 from Chitramuthu et al., 2017
thigmotaxis decreased process quality, abnormal	ml2Tg + MO4-grna	standard conditions	Fig. 1 , Fig. 2 , Fig. 5 from Chitramuthu et al., 2017
CaP motoneuron axon decreased length, abnormal	ml2Tg + MO4-grna	standard conditions	Fig. 1 , Fig. 2 , Fig. 5 from Chitramuthu et al., 2017
somite border shape, abnormal	ml2Tg + MO4-grna	standard conditions	Fig. 2 from Chitramuthu et al., 2017
spinal cord decreased length, abnormal	ml2Tg + MO4-grna	standard conditions	Fig. 2 from Chitramuthu et al., 2017
myotome acetylcholine-gated channel complex disorganized, abnormal	ml2Tg + MO4-grna	standard conditions	Fig. 2 from Chitramuthu et al., 2017

Citations