Morpholino

MO3-itgb1b

ID
ZDB-MRPHLNO-101103-2
Name
MO3-itgb1b
Previous Names
  • β1bEl10 (1)
Target
Sequence
5' - GCCAGTTTGAGTGAATAACTCACCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-itgb1b
Expressed Gene Anatomy Figures
sox32 Fig. 4 with image from Ablooglu et al., 2010
spaw Fig. 4 with image from Ablooglu et al., 2010
tbxta Fig. 4 with image from Ablooglu et al., 2010
Phenotype
Phenotype resulting from MO3-itgb1b
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal WT + MO3-itgb1b Fig. 4 with image from Ablooglu et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO3-itgb1b Fig. 4 with image from Ablooglu et al., 2010
forerunner cell group circular, abnormal ha01Tg + MO3-itgb1b Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group detached from forerunner cell group, abnormal ha01Tg + MO3-itgb1b Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group orientation forerunner cell group, abnormal ha01Tg + MO3-itgb1b Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal WT + MO3-itgb1b Fig. 4 with image,  Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group pseudopodium direction, abnormal ha01Tg + MO3-itgb1b Fig. 5 with image from Ablooglu et al., 2010
head morphology, abnormal WT + MO3-itgb1b Fig. 4 with image from Ablooglu et al., 2010
heart tube positional polarity, abnormal WT + MO3-itgb1b Fig. 4 with image from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal WT + MO3-itgb1b Fig. 7 with image from Ablooglu et al., 2010
Kupffer's vesicle unlumenized, abnormal ha01Tg + MO3-itgb1b Fig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO3-itgb1b Fig. 7 with image,  Fig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle epithelial cell apical-basal polarity, abnormal ha01Tg + MO3-itgb1b Fig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle development disrupted, abnormal ha01Tg + MO3-itgb1b Fig. 8 with image from Ablooglu et al., 2010
pericardium edematous, abnormal WT + MO3-itgb1b Fig. 4 with image from Ablooglu et al., 2010
post-vent region undulate, abnormal WT + MO3-itgb1b Fig. 4 with image from Ablooglu et al., 2010
somite U-shaped, abnormal WT + MO3-itgb1b Fig. 4 with image from Ablooglu et al., 2010
ventricular system increased accumulation cerebral spinal fluid, abnormal WT + MO3-itgb1b Fig. 4 with image from Ablooglu et al., 2010
Phenotype of all Fish created by or utilizing MO3-itgb1b
Phenotype Fish Conditions Figures
forerunner cell group spatial pattern, abnormal WT + MO3-itgb1b standard conditions Fig. 4 with image from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal WT + MO3-itgb1b standard conditions Fig. 7 with image from Ablooglu et al., 2010
post-vent region undulate, abnormal WT + MO3-itgb1b standard conditions Fig. 4 with image from Ablooglu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO3-itgb1b standard conditions Fig. 4 with image from Ablooglu et al., 2010
heart tube positional polarity, abnormal WT + MO3-itgb1b standard conditions Fig. 4 with image from Ablooglu et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO3-itgb1b standard conditions Fig. 4 with image from Ablooglu et al., 2010
somite U-shaped, abnormal WT + MO3-itgb1b standard conditions Fig. 4 with image from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO3-itgb1b standard conditions Fig. 7 with image from Ablooglu et al., 2010
pericardium edematous, abnormal WT + MO3-itgb1b standard conditions Fig. 4 with image from Ablooglu et al., 2010
head morphology, abnormal WT + MO3-itgb1b standard conditions Fig. 4 with image from Ablooglu et al., 2010
ventricular system increased accumulation cerebral spinal fluid, abnormal WT + MO3-itgb1b standard conditions Fig. 4 with image from Ablooglu et al., 2010
forerunner cell group orientation forerunner cell group, abnormal ha01Tg + MO3-itgb1b standard conditions Fig. 5 with image from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal ha01Tg + MO3-itgb1b standard conditions Fig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle development disrupted, abnormal ha01Tg + MO3-itgb1b standard conditions Fig. 8 with image from Ablooglu et al., 2010
forerunner cell group pseudopodium direction, abnormal ha01Tg + MO3-itgb1b standard conditions Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group circular, abnormal ha01Tg + MO3-itgb1b standard conditions Fig. 5 with image from Ablooglu et al., 2010
Kupffer's vesicle unlumenized, abnormal ha01Tg + MO3-itgb1b standard conditions Fig. 8 with image from Ablooglu et al., 2010
Kupffer's vesicle epithelial cell apical-basal polarity, abnormal ha01Tg + MO3-itgb1b standard conditions Fig. 8 with image from Ablooglu et al., 2010
forerunner cell group detached from forerunner cell group, abnormal ha01Tg + MO3-itgb1b standard conditions Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal ha01Tg + MO3-itgb1b standard conditions Fig. 5 with image from Ablooglu et al., 2010
forerunner cell group mislocalised, abnormal AB + MO1-wdr18 + MO3-itgb1b standard conditions Fig. 7 with image from Gao et al., 2011
determination of left/right symmetry disrupted, abnormal AB + MO1-wdr18 + MO3-itgb1b standard conditions Fig. 7 with image from Gao et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.