Morpholino

MO2-cbfb

ID
ZDB-MRPHLNO-101021-5
Name
MO2-cbfb
Previous Names
None
Target
Sequence
5' - GTATTTAATCTGTAAACAGGGATGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cbfb
Expressed Gene Anatomy Figures
nppa Fig. 5 from Meder et al., 2010
vegfaa Fig. 5 from Meder et al., 2010
Phenotype
Phenotype resulting from MO2-cbfb
Phenotype Fish Figures
atrium dilated, abnormal AB/TU + MO2-cbfb Fig. 3 from Meder et al., 2010
blood circulation disrupted, abnormal AB/TU + MO2-cbfb Fig. 3 from Meder et al., 2010
cardiac muscle cell has fewer parts of type cardiac muscle cell myosin filament, abnormal AB/TU + MO2-cbfb Fig. 4 from Meder et al., 2010
cardiac muscle cell intercalated disc malformed, abnormal AB/TU + MO2-cbfb Fig. 4 from Meder et al., 2010
cardiac muscle cell sarcomere decreased thickness, abnormal AB/TU + MO2-cbfb Fig. 4 from Meder et al., 2010
cardiac muscle cell Z disc malformed, abnormal AB/TU + MO2-cbfb Fig. 4 from Meder et al., 2010
cardiac ventricle dilated, abnormal AB/TU + MO2-cbfb Fig. 3 from Meder et al., 2010
heart non-functional, abnormal AB/TU + MO2-cbfb Fig. 3 from Meder et al., 2010
heart contraction disrupted, abnormal AB/TU + MO2-cbfb Fig. 3,  text only from Meder et al., 2010
locomotory behavior disrupted, abnormal AB/TU + MO2-cbfb text only from Meder et al., 2010
sarcomerogenesis disrupted, abnormal AB/TU + MO2-cbfb Fig. 4 from Meder et al., 2010
skeletal muscle decreased functionality, abnormal AB/TU + MO2-cbfb text only from Meder et al., 2010
skeletal muscle cell has fewer parts of type skeletal muscle cell myosin filament, abnormal AB/TU + MO2-cbfb Fig. 4 from Meder et al., 2010
Phenotype of all Fish created by or utilizing MO2-cbfb
Phenotype Fish Conditions Figures
blood circulation disrupted, abnormal AB/TU + MO2-cbfb standard conditions Fig. 3 from Meder et al., 2010
skeletal muscle decreased functionality, abnormal AB/TU + MO2-cbfb standard conditions text only from Meder et al., 2010
cardiac ventricle dilated, abnormal AB/TU + MO2-cbfb standard conditions Fig. 3 from Meder et al., 2010
locomotory behavior disrupted, abnormal AB/TU + MO2-cbfb standard conditions text only from Meder et al., 2010
heart contraction disrupted, abnormal AB/TU + MO2-cbfb standard conditions Fig. 3,  text only from Meder et al., 2010
atrium dilated, abnormal AB/TU + MO2-cbfb standard conditions Fig. 3 from Meder et al., 2010
cardiac muscle cell has fewer parts of type cardiac muscle cell myosin filament, abnormal AB/TU + MO2-cbfb standard conditions Fig. 4 from Meder et al., 2010
cardiac muscle cell Z disc malformed, abnormal AB/TU + MO2-cbfb standard conditions Fig. 4 from Meder et al., 2010
skeletal muscle cell has fewer parts of type skeletal muscle cell myosin filament, abnormal AB/TU + MO2-cbfb standard conditions Fig. 4 from Meder et al., 2010
cardiac muscle cell intercalated disc malformed, abnormal AB/TU + MO2-cbfb standard conditions Fig. 4 from Meder et al., 2010
sarcomerogenesis disrupted, abnormal AB/TU + MO2-cbfb standard conditions Fig. 4 from Meder et al., 2010
heart non-functional, abnormal AB/TU + MO2-cbfb standard conditions Fig. 3 from Meder et al., 2010
cardiac muscle cell sarcomere decreased thickness, abnormal AB/TU + MO2-cbfb standard conditions Fig. 4 from Meder et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.