Morpholino

MO3-klf6a

ID

ZDB-MRPHLNO-100811-6

Name

MO3-klf6a

Previous Names

None

Target

klf6a (1)

Sequence

5' - TGCACATTGGTAGAACATCCATTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-klf6a

Expressed Gene	Anatomy	Figures
amy2a	whole organism	Fig. 6 from Zhao et al., 2010
ces2a	whole organism	Fig. 3 from Zhao et al., 2010
cyp2y3	whole organism	Fig. 3 from Zhao et al., 2010
cyp3c1	whole organism	Fig. 3 from Zhao et al., 2010
fabp2	intestinal epithelium whole organism	Fig. 6 from Zhao et al., 2010
fabp10a	hepatocyte whole organism	Fig. 3 from Zhao et al., 2010
gata6	endoderm	Fig. 3 from Zhao et al., 2010
hpxa	whole organism	Fig. 3 from Zhao et al., 2010
ins	pancreas whole organism	Fig. 6 from Zhao et al., 2010
mttp	whole organism	Fig. 3 from Zhao et al., 2010
prox1a	liver	Fig. 3 from Zhao et al., 2010
tfa	whole organism	Fig. 3 from Zhao et al., 2010
zgc:92590	pancreas whole organism	Fig. 6 from Zhao et al., 2010

Phenotype

Phenotype resulting from MO3-klf6a

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	WT + MO3-klf6a	Fig. 2 , text only from Zhao et al., 2010
cell death increased occurrence, abnormal	WT + MO3-klf6a	Fig. 4 from Zhao et al., 2010
cell population proliferation decreased occurrence, abnormal	WT + MO3-klf6a	Fig. 5 from Zhao et al., 2010
exocrine pancreas decreased size, abnormal	WT + MO3-klf6a	Fig. 6 from Zhao et al., 2010
eye decreased size, abnormal	gz15Tg + MO3-klf6a	Fig. 2 from Zhao et al., 2010
gut decreased size, abnormal	gz15Tg + MO3-klf6a	Fig. 2 from Zhao et al., 2010
intestinal villus absent, abnormal	WT + MO3-klf6a	Fig. 6 from Zhao et al., 2010
intestine decreased size, abnormal	WT + MO3-klf6a	Fig. 6 from Zhao et al., 2010
liver decreased size, abnormal	gz15Tg + MO3-klf6a	Fig. 2 , Fig. 3 , Fig. 5 from Zhao et al., 2010
liver development disrupted, abnormal	WT + MO3-klf6a	Fig. 5 from Zhao et al., 2010
mandibular arch skeleton decreased size, abnormal	gz15Tg + MO3-klf6a	Fig. 2 from Zhao et al., 2010
pericardium edematous, abnormal	gz15Tg + MO3-klf6a	Fig. 2 from Zhao et al., 2010
whole organism decreased size, abnormal	gz15Tg + MO3-klf6a	Fig. 2 from Zhao et al., 2010

Phenotype of all Fish created by or utilizing MO3-klf6a

Phenotype	Fish	Conditions	Figures
exocrine pancreas decreased size, abnormal	WT + MO3-klf6a	standard conditions	Fig. 6 from Zhao et al., 2010
blood circulation disrupted, abnormal	WT + MO3-klf6a	standard conditions	text only from Zhao et al., 2010
intestine decreased size, abnormal	WT + MO3-klf6a	standard conditions	Fig. 6 from Zhao et al., 2010
liver development disrupted, abnormal	WT + MO3-klf6a	standard conditions	Fig. 5 from Zhao et al., 2010
cell death increased occurrence, abnormal	WT + MO3-klf6a	standard conditions	Fig. 4 from Zhao et al., 2010
cell population proliferation decreased occurrence, abnormal	WT + MO3-klf6a	standard conditions	Fig. 5 from Zhao et al., 2010
liver decreased size, abnormal	WT + MO3-klf6a	standard conditions	Fig. 3 , Fig. 5 from Zhao et al., 2010
intestinal villus absent, abnormal	WT + MO3-klf6a	standard conditions	Fig. 6 from Zhao et al., 2010
gut decreased size, abnormal	gz15Tg + MO3-klf6a	standard conditions	Fig. 2 from Zhao et al., 2010
mandibular arch skeleton decreased size, abnormal	gz15Tg + MO3-klf6a	standard conditions	Fig. 2 from Zhao et al., 2010
eye decreased size, abnormal	gz15Tg + MO3-klf6a	standard conditions	Fig. 2 from Zhao et al., 2010
liver decreased size, abnormal	gz15Tg + MO3-klf6a	standard conditions	Fig. 2 from Zhao et al., 2010
pericardium edematous, abnormal	gz15Tg + MO3-klf6a	standard conditions	Fig. 2 from Zhao et al., 2010
blood circulation disrupted, abnormal	gz15Tg + MO3-klf6a	standard conditions	Fig. 2 from Zhao et al., 2010
whole organism decreased size, abnormal	gz15Tg + MO3-klf6a	standard conditions	Fig. 2 from Zhao et al., 2010

Citations