Morpholino

MO1-gjc4b

ID

ZDB-MRPHLNO-100518-3

Name

MO1-gjc4b

Previous Names

MO1-cx43.4

Target

gjc4b (1)

Sequence

5' - TCAAGAAGTACCACCGTCTCAGTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation blocking MO, targets 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gjc4b

Expressed Gene	Anatomy	Figures
gjc4b	(not) Kupffer's vesicle	Fig. 2 from Hatler et al., 2009
lft1	diencephalon right side	Fig. 3 from Hatler et al., 2009
lft2	heart rudiment left side	Fig. 3 from Hatler et al., 2009
myl7	heart tube	Fig. 1 from Hatler et al., 2009
spaw	lateral mesoderm left side	Fig. 3 from Hatler et al., 2009
tbxta	notochord	Fig. 4 from Hatler et al., 2009

Phenotype

Phenotype resulting from MO1-gjc4b

Phenotype	Fish	Figures
cilium assembly disrupted, abnormal	WT + MO1-gjc4b	Fig. 5 from Hatler et al., 2009
determination of digestive tract left/right asymmetry disrupted, abnormal	WT + MO1-gjc4b	Fig. 1 from Hatler et al., 2009
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-gjc4b	Fig. 1 , Fig. 2 from Hatler et al., 2009
determination of left/right symmetry disrupted, abnormal	WT + MO1-gjc4b	Fig. 3 from Hatler et al., 2009
gall bladder mislocalised radially, abnormal	WT + MO1-gjc4b	Fig. 1 from Hatler et al., 2009
heart looping disrupted, abnormal	WT + MO1-gjc4b	Fig. 1 , Fig. 2 from Hatler et al., 2009
heart tube mislocalised radially, abnormal	WT + MO1-gjc4b	Fig. 1 , Fig. 2 from Hatler et al., 2009
Kupffer's vesicle hypoplastic, abnormal	WT + MO1-gjc4b	Fig. 6 from Hatler et al., 2009
Kupffer's vesicle unlumenized, abnormal	WT + MO1-gjc4b	Fig. 6 from Hatler et al., 2009
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO1-gjc4b	Fig. 5 from Hatler et al., 2009
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-gjc4b	Fig. 5 from Hatler et al., 2009
Kupffer's vesicle development arrested, abnormal	WT + MO1-gjc4b	Fig. 6 from Hatler et al., 2009
pancreatic bud mislocalised radially, abnormal	WT + MO1-gjc4b	Fig. 1 from Hatler et al., 2009

Phenotype of all Fish created by or utilizing MO1-gjc4b

Phenotype	Fish	Conditions	Figures
gall bladder mislocalised radially, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 1 from Hatler et al., 2009
determination of left/right symmetry disrupted, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 3 from Hatler et al., 2009
Kupffer's vesicle unlumenized, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 6 from Hatler et al., 2009
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 5 from Hatler et al., 2009
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 1 , Fig. 2 from Hatler et al., 2009
heart tube mislocalised radially, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 1 , Fig. 2 from Hatler et al., 2009
pancreatic bud mislocalised radially, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 1 from Hatler et al., 2009
Kupffer's vesicle development arrested, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 6 from Hatler et al., 2009
Kupffer's vesicle hypoplastic, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 6 from Hatler et al., 2009
cilium assembly disrupted, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 5 from Hatler et al., 2009
Kupffer's vesicle cilium decreased length, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 5 from Hatler et al., 2009
determination of digestive tract left/right asymmetry disrupted, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 1 from Hatler et al., 2009
heart looping disrupted, abnormal	WT + MO1-gjc4b	standard conditions	Fig. 1 , Fig. 2 from Hatler et al., 2009

Citations