Morpholino

MO1-znf703

ID
ZDB-MRPHLNO-090413-3
Name
MO1-znf703
Previous Names
  • nlz1 MO
Target
Sequence
5' - ATCCAGGAGGCAGTTCGCTCATCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-znf703
Expressed Gene Anatomy Figures
cdh17 Fig. 1 with image from Dutta et al., 2015
dand5 Fig. 3 with image from Dutta et al., 2015
lft2 Fig. 2 with image from Dutta et al., 2015
myl7 Fig. 2 with image from Dutta et al., 2015
nphs2 Fig. 1 with image from Dutta et al., 2015
pax2a Fig. 5 with image from Brown et al., 2009
pax6a Fig. 5 with image from Brown et al., 2009
sox32 Fig. 3 with image from Dutta et al., 2015
spaw Fig. 2 with image from Dutta et al., 2015
vax1 Fig. 5 with image from Brown et al., 2009
vax2 Fig. 5 with image from Brown et al., 2009
wnt11f2 Fig. 5 with image from Dutta et al., 2015
Phenotype
Phenotype resulting from MO1-znf703
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
cranial skeletal system development disrupted, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-znf703 Fig. 2 with image,  Fig. 5 with image from Dutta et al., 2015
determination of left/right symmetry disrupted, abnormal WT + MO1-znf703 Fig. 2 with image,  Fig. 5 with image from Dutta et al., 2015
embryonic camera-type eye morphogenesis disrupted, abnormal WT + MO1-znf703 Fig. 2 with image,  Fig. 3 with image from Brown et al., 2009
eye malformed, abnormal WT + MO1-znf703 Fig. 2 with image,  Fig. 3 with image from Brown et al., 2009
floor plate motile cilium decreased amount, abnormal WT + MO1-znf703 Fig. 3 with image,  Fig. 5 with image from Dutta et al., 2015
forerunner cell group wnt11f2 expression decreased distribution, abnormal WT + MO1-znf703 Fig. 5 with image from Dutta et al., 2015
heart tube mislocalised, abnormal WT + MO1-znf703 Fig. 2 with image from Dutta et al., 2015
Kupffer's vesicle wnt11f2 expression decreased distribution, abnormal WT + MO1-znf703 Fig. 5 with image from Dutta et al., 2015
Kupffer's vesicle decreased size, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
Kupffer's vesicle lacks all parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-znf703 Fig. 3 with image,  Fig. 5 with image from Dutta et al., 2015
Kupffer's vesicle anatomical region dand5 expression absent, abnormal WT + MO1-znf703 Fig. 3 with image from Dutta et al., 2015
Kupffer's vesicle motile cilium absent, abnormal WT + MO1-znf703 Fig. 3 with image,  Fig. 5 with image from Dutta et al., 2015
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-znf703 Fig. 2 with image from Dutta et al., 2015
lateral plate mesoderm right side lft2 expression mislocalised, abnormal WT + MO1-znf703 Fig. 2 with image from Dutta et al., 2015
ocular blood vessel malformed, abnormal WT + MO1-znf703 Fig. 3 with image from Brown et al., 2009
optic fissure closure incomplete, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
Fig. 2 with image,  Fig. 3 with image from Brown et al., 2009
otolith increased amount, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
pericardium edematous, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
post-vent region increased curvature, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
pronephric glomerulus nphs2 expression absent, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
pronephros cystic, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
pronephros motile cilium decreased amount, abnormal WT + MO1-znf703 Fig. 3 with image from Dutta et al., 2015
retina malformed, abnormal WT + MO1-znf703 Fig. 3 with image from Brown et al., 2009
retinal pigmented epithelium split, abnormal WT + MO1-znf703 Fig. 3 with image from Brown et al., 2009
whole organism wnt11f2 expression decreased amount, abnormal WT + MO1-znf703 Fig. 5 with image from Dutta et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-znf703 Fig. 1 with image from Dutta et al., 2015
Phenotype of all Fish created by or utilizing MO1-znf703
Phenotype Fish Conditions Figures
eye malformed, abnormal WT + MO1-znf703 standard conditions Fig. 2 with image,  Fig. 3 with image from Brown et al., 2009
pronephric glomerulus nphs2 expression absent, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
Kupffer's vesicle wnt11f2 expression decreased distribution, abnormal WT + MO1-znf703 standard conditions Fig. 5 with image from Dutta et al., 2015
embryonic camera-type eye morphogenesis disrupted, abnormal WT + MO1-znf703 chemical treatment: messenger RNA Fig. 6 with image from Brown et al., 2009
pronephros cystic, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
Kupffer's vesicle motile cilium absent, abnormal WT + MO1-znf703 standard conditions Fig. 3 with image,  Fig. 5 with image from Dutta et al., 2015
post-vent region increased curvature, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-znf703 standard conditions Fig. 2 with image,  Fig. 5 with image from Dutta et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
heart tube mislocalised, abnormal WT + MO1-znf703 standard conditions Fig. 2 with image from Dutta et al., 2015
lateral plate mesoderm right side spaw expression mislocalised, abnormal WT + MO1-znf703 standard conditions Fig. 2 with image from Dutta et al., 2015
determination of left/right symmetry disrupted, abnormal WT + MO1-znf703 standard conditions Fig. 2 with image,  Fig. 5 with image from Dutta et al., 2015
floor plate motile cilium decreased amount, abnormal WT + MO1-znf703 standard conditions Fig. 3 with image,  Fig. 5 with image from Dutta et al., 2015
embryonic camera-type eye morphogenesis disrupted, abnormal WT + MO1-znf703 standard conditions Fig. 2 with image,  Fig. 3 with image from Brown et al., 2009
retinal pigmented epithelium split, abnormal WT + MO1-znf703 standard conditions Fig. 3 with image from Brown et al., 2009
forerunner cell group wnt11f2 expression decreased distribution, abnormal WT + MO1-znf703 standard conditions Fig. 5 with image from Dutta et al., 2015
lateral plate mesoderm right side lft2 expression mislocalised, abnormal WT + MO1-znf703 standard conditions Fig. 2 with image from Dutta et al., 2015
pericardium edematous, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
Kupffer's vesicle decreased size, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
ocular blood vessel malformed, abnormal WT + MO1-znf703 standard conditions Fig. 3 with image from Brown et al., 2009
whole organism wnt11f2 expression decreased amount, abnormal WT + MO1-znf703 standard conditions Fig. 5 with image from Dutta et al., 2015
Kupffer's vesicle lacks all parts of type Kupffer's vesicle motile cilium, abnormal WT + MO1-znf703 standard conditions Fig. 3 with image,  Fig. 5 with image from Dutta et al., 2015
brain hydrocephalic, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
retina malformed, abnormal WT + MO1-znf703 standard conditions Fig. 3 with image from Brown et al., 2009
otolith increased amount, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
Kupffer's vesicle anatomical region dand5 expression absent, abnormal WT + MO1-znf703 standard conditions Fig. 3 with image from Dutta et al., 2015
cranial skeletal system development disrupted, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
optic fissure closure incomplete, abnormal WT + MO1-znf703 standard conditions Fig. 1 with image from Dutta et al., 2015
Fig. 2 with image,  Fig. 3 with image from Brown et al., 2009
pronephros motile cilium decreased amount, abnormal WT + MO1-znf703 standard conditions Fig. 3 with image from Dutta et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.