Morpholino

MO2-diaph2

ID
ZDB-MRPHLNO-090115-2
Name
MO2-diaph2
Previous Names
  • sMO (1)
Target
Sequence
5' - TGTTGTGGTGCACTTACAGATTTGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino targeting the splicing donor of the fourth intron to delete the core Rho-binding domain.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-diaph2
Expressed Gene Anatomy Figures
ctslb Fig. S2 with image from Lai et al., 2008
gsc Fig. 5 with image,  Fig. S5 with image from Lai et al., 2008
myod1 Fig. S2 with image from Lai et al., 2008
tbxta Fig. 5 with image,  Fig. S5 with image from Lai et al., 2008
Phenotype
Phenotype resulting from MO2-diaph2
Phenotype Fish Figures
axis decreased length, abnormal WT + MO2-diaph2 Fig. 5 with image,  Fig. S2 with image,  Fig. S5 with image from Lai et al., 2008
bleb assembly disrupted, abnormal WT + MO2-diaph2 Fig. 6 with image from Lai et al., 2008
cell migration involved in gastrulation decreased rate, abnormal WT + MO2-diaph2 Fig. 6 with image from Lai et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-diaph2 Fig. 5 with image,  Fig. S2 with image,  Fig. S5 with image,  text only from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second arrested, abnormal WT + MO2-diaph2 Fig. 5 with image from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO2-diaph2 Fig. S4 with image,  text only from Lai et al., 2008
hypoblast cell projection decreased amount, abnormal WT + MO2-diaph2 Fig. 7 with image from Lai et al., 2008
margin bleb absent, abnormal WT + MO2-diaph2 Fig. 6 with image from Lai et al., 2008
margin filamentous actin decreased amount, abnormal WT + MO2-diaph2 Fig. 8 with image from Lai et al., 2008
notochord increased width, abnormal WT + MO2-diaph2 Fig. 5 with image,  Fig. S5 with image from Lai et al., 2008
prechordal plate cell projection decreased amount, abnormal WT + MO2-diaph2 Fig. 7 with image from Lai et al., 2008
somite increased width, abnormal WT + MO2-diaph2 Fig. S2 with image from Lai et al., 2008
tail bud aplastic, abnormal WT + MO2-diaph2 Fig. 5 with image from Lai et al., 2008
yolk syncytial layer filamentous actin absent, abnormal WT + MO2-diaph2 Fig. S4 with image from Lai et al., 2008
Phenotype of all Fish created by or utilizing MO2-diaph2
Phenotype Fish Conditions Figures
somite increased width, abnormal WT + MO2-diaph2 standard conditions Fig. S2 with image from Lai et al., 2008
tail bud aplastic, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with image from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO2-diaph2 standard conditions Fig. S4 with image,  text only from Lai et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with image,  Fig. S2 with image,  Fig. S5 with image,  text only from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second arrested, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with image from Lai et al., 2008
hypoblast cell projection decreased amount, abnormal WT + MO2-diaph2 standard conditions Fig. 7 with image from Lai et al., 2008
margin filamentous actin decreased amount, abnormal WT + MO2-diaph2 standard conditions Fig. 8 with image from Lai et al., 2008
yolk syncytial layer filamentous actin absent, abnormal WT + MO2-diaph2 standard conditions Fig. S4 with image from Lai et al., 2008
bleb assembly disrupted, abnormal WT + MO2-diaph2 standard conditions Fig. 6 with image from Lai et al., 2008
notochord increased width, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with image,  Fig. S5 with image from Lai et al., 2008
prechordal plate cell projection decreased amount, abnormal WT + MO2-diaph2 standard conditions Fig. 7 with image from Lai et al., 2008
axis decreased length, abnormal WT + MO2-diaph2 standard conditions Fig. 5 with image,  Fig. S2 with image,  Fig. S5 with image from Lai et al., 2008
margin bleb absent, abnormal WT + MO2-diaph2 standard conditions Fig. 6 with image from Lai et al., 2008
cell migration involved in gastrulation decreased rate, abnormal WT + MO2-diaph2 standard conditions Fig. 6 with image from Lai et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-pfn1 + MO2-diaph2 standard conditions Fig. S5 with image,  text only from Lai et al., 2008
notochord increased width, abnormal WT + MO1-pfn1 + MO2-diaph2 standard conditions Fig. S5 with image from Lai et al., 2008
axis decreased length, abnormal WT + MO1-pfn1 + MO2-diaph2 standard conditions Fig. S5 with image from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-pfn1 + MO2-diaph2 standard conditions text only from Lai et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-pfn2b + MO2-diaph2 standard conditions text only from Lai et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-pfn2b + MO2-diaph2 standard conditions text only from Lai et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.