Morpholino

MO1-barx1

ID
ZDB-MRPHLNO-081120-1
Name
MO1-barx1
Previous Names
  • Bx MO (1)
Target
Sequence
5' - CCCCAATCTCCAAAGGATGTTGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the translational start site of barx1.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-barx1
No data available
Phenotype
Phenotype resulting from MO1-barx1
Phenotype of all Fish created by or utilizing MO1-barx1
Phenotype Fish Conditions Figures
pharyngeal arch decreased size, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
cartilage development disrupted, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with imageFig. S4 with image from Sperber et al., 2008
head decreased size, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
pharyngeal arch cartilage chondroblast disorganized, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with imageFig. S4 with image from Sperber et al., 2008
chondroblast extracellular matrix absent, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with imageFig. S4 with image from Sperber et al., 2008
pharyngeal arch morphology, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
ceratobranchial cartilage aplastic, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
mandibular arch skeleton decreased size, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
embryonic skeletal joint morphogenesis disrupted, abnormal EKW + MO1-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
odontogenesis paedomorphic growth, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with imageFig. S5 with image from Sperber et al., 2008
ceratobranchial 5 tooth decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with image from Sperber et al., 2008
pharyngeal arch mesenchyme morphology, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 7 with image from Sperber et al., 2008
mandibular arch skeleton decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 3 with image from Sperber et al., 2008
head decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with image from Sperber et al., 2008
cartilage development disrupted, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 3 with imageFig. 5 with imageFig. 7 with image from Sperber et al., 2008
pharyngeal arch decreased size, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 5 with image from Sperber et al., 2008
embryonic skeletal joint morphogenesis process quality, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 6 with image from Sperber et al., 2008
ceratobranchial 5 tooth immature, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. S5 with image from Sperber et al., 2008
embryo development delayed, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 4 with image from Sperber et al., 2008
cell population proliferation decreased rate, abnormal EKW + MO1-barx1 + MO2-barx1 standard conditions Fig. 7 with image from Sperber et al., 2008
cartilage development delayed, abnormal y1Tg + MO1-barx1 standard conditions Fig. S4 with image from Sperber et al., 2008
Citations