Morpholino

MO5-cxcr4a

ID
ZDB-MRPHLNO-081114-3
Name
MO5-cxcr4a
Previous Names
  • cxcr4aMO1 (1)
Target
Sequence
5' - CGATGTGTCCGTAATAAGCCATCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-cxcr4a
Expressed Gene Anatomy Figures
cp Fig. 2 with image from Mizoguchi et al., 2008
ctslb Fig. 4 with image from Mizoguchi et al., 2008
dlx3b Fig. 4 with image from Mizoguchi et al., 2008
foxa3 Fig. 2 with image from Mizoguchi et al., 2008
ins Fig. 2 with image from Mizoguchi et al., 2008
myod1 Fig. 4 with image from Mizoguchi et al., 2008
pdx1 Fig. 2 with image from Mizoguchi et al., 2008
sox17 Fig. 2 with image from Mizoguchi et al., 2008
tbxta Fig. 4 with image from Mizoguchi et al., 2008
Phenotype
Phenotype resulting from MO5-cxcr4a
Phenotype Fish Figures
cell migration involved in gastrulation delayed, abnormal ha01Tg + MO5-cxcr4a Fig. 2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation process quality, abnormal ha01Tg + MO5-cxcr4a Fig. 6 with image from Mizoguchi et al., 2008
endodermal cell circular, abnormal ha01Tg + MO5-cxcr4a Fig. 6 with image from Mizoguchi et al., 2008
endodermal cell filopodium decreased amount, abnormal ha01Tg + MO5-cxcr4a Fig. 6 with image from Mizoguchi et al., 2008
endodermal cell filopodium orientation whole organism dorsal-ventral axis, abnormal ha01Tg + MO5-cxcr4a Fig. 6 with image from Mizoguchi et al., 2008
gut bifurcated, abnormal ha01Tg + MO5-cxcr4a Fig. 2 with image from Mizoguchi et al., 2008
gut morphology, abnormal WT + MO5-cxcr4a Fig. 2 with image from Mizoguchi et al., 2008
liver decreased size, abnormal WT + MO5-cxcr4a Fig. 2 with image from Mizoguchi et al., 2008
pancreas decreased size, abnormal WT + MO5-cxcr4a Fig. 2 with image from Mizoguchi et al., 2008
pancreas morphology, abnormal WT + MO5-cxcr4a Fig. 2 with image from Mizoguchi et al., 2008
pancreas pancreatic B cell dispersed, abnormal WT + MO5-cxcr4a Fig. 2 with image from Mizoguchi et al., 2008
Phenotype of all Fish created by or utilizing MO5-cxcr4a
Phenotype Fish Conditions Figures
pancreas pancreatic B cell dispersed, abnormal WT + MO5-cxcr4a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
liver decreased size, abnormal WT + MO5-cxcr4a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation delayed, abnormal WT + MO5-cxcr4a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
pancreas morphology, abnormal WT + MO5-cxcr4a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
gut morphology, abnormal WT + MO5-cxcr4a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
pancreas decreased size, abnormal WT + MO5-cxcr4a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
endodermal cell filopodium decreased amount, abnormal ha01Tg + MO5-cxcr4a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
gut bifurcated, abnormal ha01Tg + MO5-cxcr4a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation delayed, abnormal ha01Tg + MO5-cxcr4a standard conditions Fig. 2 with image from Mizoguchi et al., 2008
cell migration involved in gastrulation process quality, abnormal ha01Tg + MO5-cxcr4a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
endodermal cell filopodium orientation whole organism dorsal-ventral axis, abnormal ha01Tg + MO5-cxcr4a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
endodermal cell circular, abnormal ha01Tg + MO5-cxcr4a standard conditions Fig. 6 with image from Mizoguchi et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.