Morpholino
MO3-sparc
- ID
- ZDB-MRPHLNO-081105-2
- Name
- MO3-sparc
- Previous Names
-
- E3I3-MO (1)
- Target
- Sequence
-
5' - GAAAAATGAACTCACTCTCAGCAAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sparc
Expressed Gene | Anatomy | Figures |
---|---|---|
atp1a1a.4 |
Fig. 7,
Fig. 8
from Rotllant et al., 2008 |
|
cldna |
Fig. 6
from Rotllant et al., 2008 |
|
col2a1a |
Fig. 4,
Fig. 8
from Rotllant et al., 2008 |
|
dlx2a |
Fig. 4
from Rotllant et al., 2008 |
|
dlx3b |
Fig. 6
from Rotllant et al., 2008 |
|
eya1 |
Fig. 6
from Rotllant et al., 2008 |
|
gata1a |
Fig. 2
from Ceinos et al., 2013 |
|
hbbe3 |
Fig. 2
from Ceinos et al., 2013 |
|
lcp1 |
Fig. 2
from Ceinos et al., 2013 |
|
msx3 |
Fig. 7,
Fig. 8
from Rotllant et al., 2008 |
|
myb |
Fig. 3
from Ceinos et al., 2013 |
|
otx1 |
|
Fig. 6,
Fig. 8
from Rotllant et al., 2008 |
rag1 |
Fig. 2
from Ceinos et al., 2013 |
|
runx1 |
Fig. 4
from Ceinos et al., 2013 |
|
sox9a |
Fig. 4
from Rotllant et al., 2008 |
|
sox9b |
Fig. 4
from Rotllant et al., 2008 |
|
sparc |
Fig. 3
from Rotllant et al., 2008 |
|
spi1b |
Fig. 2
from Ceinos et al., 2013 |
|
stm |
Fig. 6
from Rotllant et al., 2008 |
Phenotype
Phenotype resulting from MO3-sparc
No data available
Phenotype of all Fish created by or utilizing MO3-sparc
No data available
Citations