Morpholino

MO4-mmp14a

ID
ZDB-MRPHLNO-081029-4
Name
MO4-mmp14a
Previous Names
None
Target
Sequence
5' - GACGGTACTCAAGTCGGGACACAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-mmp14a
Expressed Gene Anatomy Figures
dlc Fig. 3 from Coyle et al., 2008
egr2b Fig. S2 from Coyle et al., 2008
myod1 Fig. S2 from Coyle et al., 2008
pax2b Fig. 3 from Coyle et al., 2008
six3b Fig. 3 from Coyle et al., 2008
tbxta Fig. 3 from Coyle et al., 2008
zic1 Fig. S2 from Coyle et al., 2008
Phenotype
Phenotype resulting from MO4-mmp14a
Phenotype Fish Figures
axis decreased length, abnormal WT + MO4-mmp14a Fig. 3 from Coyle et al., 2008
brain apoptotic, abnormal WT + MO4-mmp14a Fig. 3 from Coyle et al., 2008
brain morphology, abnormal WT + MO4-mmp14a Fig. S2 from Coyle et al., 2008
cartilage development disrupted, abnormal WT + MO4-mmp14a Fig. 2 from Coyle et al., 2008
cell proliferation involved in compound eye morphogenesis increased occurrence, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 7 with image from Janssens et al., 2013
ceratohyal cartilage malformed, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 4 with image from Janssens et al., 2013
chondrocranium morphology, abnormal WT + MO4-mmp14a Fig. 2 from Coyle et al., 2008
ciliary marginal zone increased size, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 7 with image from Janssens et al., 2013
convergent extension involved in gastrulation disrupted, abnormal WT + MO4-mmp14a Fig. 3,  Fig. S2 from Coyle et al., 2008
cranial nerve II decreased thickness, abnormal rw021Tg + MO4-mmp14a + MO5-tp53 Fig. 8 with image from Janssens et al., 2013
cranial nerve II hypoplastic, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 6 with image from Janssens et al., 2013
extension decreased length, abnormal WT + MO4-mmp14a Fig. 3,  Fig. S2 from Coyle et al., 2008
eye decreased diameter, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 5 with image,  Fig. 9 with image from Janssens et al., 2013
eye decreased size, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 5 with image from Janssens et al., 2013
Meckel's cartilage malformed, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 4 with image from Janssens et al., 2013
Muller cell decreased amount, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 6 with image from Janssens et al., 2013
neural retina development delayed, abnormal rw021Tg + MO4-mmp14a + MO5-tp53 Fig. 6 with image,  Fig. 7 with image from Janssens et al., 2013
notochord increased width, abnormal WT + MO4-mmp14a Fig. 3 from Coyle et al., 2008
pericardium edematous, abnormal WT + MO4-mmp14a Fig. 4 with image from Janssens et al., 2013
retina has fewer parts of type amacrine cell, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 6 with image from Janssens et al., 2013
retina lacks all parts of type amacrine cell, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 6 with image from Janssens et al., 2013
retina morphology, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 6 with image from Janssens et al., 2013
retina proliferative region increased size, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 7 with image from Janssens et al., 2013
retina layer formation delayed, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 6 with image from Janssens et al., 2013
retina layer formation disrupted, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 6 with image from Janssens et al., 2013
retinal cone cell decreased amount, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 6 with image from Janssens et al., 2013
retinal ganglion cell decreased amount, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 6 with image from Janssens et al., 2013
retinal ganglion cell axon guidance disrupted, abnormal WT + MO4-mmp14a + MO5-tp53 Fig. 8 with image from Janssens et al., 2013
splanchnocranium morphology, abnormal WT + MO4-mmp14a Fig. 2 from Coyle et al., 2008
whole organism decreased length, abnormal WT + MO4-mmp14a Fig. 3,  Fig. S2 from Coyle et al., 2008
whole organism anterior-posterior axis deformed, abnormal WT + MO4-mmp14a Fig. 4 with image from Janssens et al., 2013
Phenotype of all Fish created by or utilizing MO4-mmp14a
Phenotype Fish Conditions Figures
brain apoptotic, abnormal WT + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
splanchnocranium morphology, abnormal WT + MO4-mmp14a standard conditions Fig. 2 from Coyle et al., 2008
axis decreased length, abnormal WT + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
whole organism decreased length, abnormal WT + MO4-mmp14a standard conditions Fig. 3,  Fig. S2 from Coyle et al., 2008
notochord increased width, abnormal WT + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO4-mmp14a standard conditions Fig. 3,  Fig. S2 from Coyle et al., 2008
chondrocranium morphology, abnormal WT + MO4-mmp14a standard conditions Fig. 2 from Coyle et al., 2008
cartilage development disrupted, abnormal WT + MO4-mmp14a standard conditions Fig. 2 from Coyle et al., 2008
whole organism anterior-posterior axis deformed, abnormal WT + MO4-mmp14a standard conditions Fig. 4 with image from Janssens et al., 2013
brain morphology, abnormal WT + MO4-mmp14a standard conditions Fig. S2 from Coyle et al., 2008
pericardium edematous, abnormal WT + MO4-mmp14a standard conditions Fig. 4 with image from Janssens et al., 2013
extension decreased length, abnormal WT + MO4-mmp14a standard conditions Fig. 3,  Fig. S2 from Coyle et al., 2008
retinal ganglion cell decreased amount, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
retinal ganglion cell axon guidance disrupted, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 8 with image from Janssens et al., 2013
eye decreased size, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 5 with image from Janssens et al., 2013
retina layer formation disrupted, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
retina has fewer parts of type amacrine cell, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
retina morphology, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
cranial nerve II hypoplastic, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
cell proliferation involved in compound eye morphogenesis increased occurrence, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 7 with image from Janssens et al., 2013
ciliary marginal zone increased size, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 7 with image from Janssens et al., 2013
ceratohyal cartilage malformed, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 4 with image from Janssens et al., 2013
neural retina development delayed, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
retina lacks all parts of type amacrine cell, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
Muller cell decreased amount, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
Meckel's cartilage malformed, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 4 with image from Janssens et al., 2013
retina layer formation delayed, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
retina proliferative region increased size, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 7 with image from Janssens et al., 2013
retinal cone cell decreased amount, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 6 with image from Janssens et al., 2013
eye decreased diameter, abnormal WT + MO4-mmp14a + MO5-tp53 standard conditions Fig. 5 with image,  Fig. 9 with image from Janssens et al., 2013
cranial nerve II decreased thickness, abnormal rw021Tg + MO4-mmp14a + MO5-tp53 standard conditions Fig. 8 with image from Janssens et al., 2013
neural retina development delayed, abnormal rw021Tg + MO4-mmp14a + MO5-tp53 standard conditions Fig. 7 with image from Janssens et al., 2013
determination of intestine left/right asymmetry disrupted, abnormal hand2c99/+ + MO4-mmp14a standard conditions Fig. 7 with image from Yin et al., 2010
eye decreased diameter, abnormal WT + MO1-mmp14b + MO4-mmp14a + MO5-tp53 standard conditions Fig. 9 with image from Janssens et al., 2013
retinal ganglion cell axon guidance disrupted, abnormal WT + MO2-mmp2 + MO4-mmp14a + MO5-tp53 standard conditions Fig. 10 with image from Janssens et al., 2013
lateral mesoderm morphology, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
mesodermal cell circular, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
mesodermal cell migration disrupted, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
establishment of cell polarity disrupted, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
mesodermal cell disorganized, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
axis decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
mesodermal cell migration rate, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 4 from Coyle et al., 2008
whole organism decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
notochord increased width, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3,  Fig. 4 from Coyle et al., 2008
brain apoptotic, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
extension decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 3 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal WT + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 3 from Coyle et al., 2008
extension decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 3 from Coyle et al., 2008
whole organism decreased length, abnormal WT + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 3 from Coyle et al., 2008
rhombomere increased width, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
somite increased width, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
forebrain increased width, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
whole organism decreased length, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal gpc4m119/+ + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
rhombomere increased width, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
post-vent region decreased length, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
somite increased width, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
forebrain increased width, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
axis increased width, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
whole organism decreased length, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
extension decreased length, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
convergent extension involved in gastrulation disrupted, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
whole organism morphology, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
axis decreased length, abnormal gpc4m119/m119 + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 5 from Coyle et al., 2008
convergent extension disrupted, abnormal AB + MO1-ptk7b + MO2-mmp14b + MO4-mmp14a standard conditions Fig. 7 from Golubkov et al., 2010
endoderm cell migration involved in gastrulation process quality, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm convergent extension involved in gastrulation process quality, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
anatomical line ab2-fn labeling increased amount, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. S7 with image from Hu et al., 2018
endoderm increased width, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. S7 with image,  Fig. S8 with image from Hu et al., 2018
endoderm convergent extension involved in gastrulation decreased efficacy, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm cell migration involved in gastrulation decreased efficacy, abnormal ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endoderm increased width, exacerbated gpc4fr6/fr6; ha01Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. S8 with image from Hu et al., 2018
endodermal cell lamellipodium decreased length, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endodermal cell lamellipodium decreased life span, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endodermal cell lamellipodium decreased amount, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
endodermal cell plasma membrane bounded cell projection increased amount, abnormal s944Tg; ui10Tg + MO2-mmp14b + MO4-mmp14a + MO4-tp53 standard conditions Fig. 7 with image from Hu et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.