Morpholino

MO2-bbs1

ID
ZDB-MRPHLNO-081027-1
Name
MO2-bbs1
Previous Names
  • bbs1_aug (1)
Target
Sequence
5' - GGGAACAGATGACATGGTTGTTTTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bbs1
Expressed Gene Anatomy Figures
myl7 Fig. 5 with image from Kim et al., 2013
Phenotype
Phenotype resulting from MO2-bbs1
Phenotype Fish Figures
axis shortened, abnormal WT + MO2-bbs1 Fig. 4 with image from Kim et al., 2013
brain hydrocephalic, abnormal WT + MO2-bbs1 Fig. 3 with image from Kim et al., 2013
cilium movement process quality, abnormal hsc5Tg + MO2-bbs1 Fig. SMovie 5,  Fig. SMovie 6,  Fig. SMovie 11,  Fig. SMovie4 from Kim et al., 2013
cloaca cilium decreased mobility, abnormal hsc5Tg + MO2-bbs1 Fig. SMovie 6 from Kim et al., 2013
convergent extension process quality, abnormal WT + MO2-bbs1 Fig. 4 with image from Kim et al., 2013
determination of left/right symmetry disrupted, abnormal WT + MO2-bbs1 text only from Tayeh et al., 2008
determination of left/right symmetry process quality, abnormal WT + MO2-bbs1 Fig. 5 with image,  Fig. S5 with image from Kim et al., 2013
determination of liver left/right asymmetry process quality, abnormal WT + MO2-bbs1 Fig. S5 with image from Kim et al., 2013
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO2-bbs1 Fig. S5 with image from Kim et al., 2013
embryonic pattern specification disrupted, abnormal WT + MO2-bbs1 Fig. 4 from Tayeh et al., 2008
embryonic pectoral fin morphogenesis disrupted, abnormal WT + MO2-bbs1 Fig. 4 from Tayeh et al., 2008
eye decreased size, abnormal WT + MO2-bbs1 Fig. S8 with image from Kim et al., 2013
heart looping disrupted, abnormal WT + MO2-bbs1 text only from Tayeh et al., 2008
heart looping process quality, abnormal WT + MO2-bbs1 Fig. 5 with image from Kim et al., 2013
Kupffer's vesicle aplastic, abnormal WT + MO2-bbs1 text only from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal WT + MO2-bbs1 Fig. 3,  text only from Tayeh et al., 2008
olfactory pit cilium decreased mobility, abnormal hsc5Tg + MO2-bbs1 Fig. SMovie 11 from Kim et al., 2013
pronephric tubule cilium decreased mobility, abnormal hsc5Tg + MO2-bbs1 Fig. SMovie 5,  Fig. SMovie4 from Kim et al., 2013
pronephric tubule cilium increased length, abnormal WT + MO2-bbs1 Fig. 7 with image from Kim et al., 2013
pronephros cystic, abnormal li1Tg + MO2-bbs1 Fig. 3 with image,  Fig. 6 with image from Kim et al., 2013
retina layer formation process quality, abnormal WT + MO2-bbs1 Fig. S8 with image from Kim et al., 2013
somite broad, abnormal WT + MO2-bbs1 Fig. 4 with image from Kim et al., 2013
trunk curved, abnormal WT + MO2-bbs1 Fig. 3 with image,  Fig. S3 with image from Kim et al., 2013
Phenotype of all Fish created by or utilizing MO2-bbs1
Phenotype Fish Conditions Figures
trunk curved, abnormal WT + MO2-bbs1 standard conditions Fig. 3 with image,  Fig. S3 with image from Kim et al., 2013
determination of liver left/right asymmetry process quality, abnormal WT + MO2-bbs1 standard conditions Fig. S5 with image from Kim et al., 2013
embryonic pattern specification disrupted, abnormal WT + MO2-bbs1 standard conditions Fig. 4 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO2-bbs1 chemical treatment: (R)-adrenaline Fig. 3 from Tayeh et al., 2008
embryonic pectoral fin morphogenesis disrupted, abnormal WT + MO2-bbs1 standard conditions Fig. 4 from Tayeh et al., 2008
heart looping process quality, abnormal WT + MO2-bbs1 standard conditions Fig. 5 with image from Kim et al., 2013
determination of left/right symmetry disrupted, abnormal WT + MO2-bbs1 standard conditions text only from Tayeh et al., 2008
convergent extension process quality, abnormal WT + MO2-bbs1 standard conditions Fig. 4 with image from Kim et al., 2013
brain hydrocephalic, abnormal WT + MO2-bbs1 standard conditions Fig. 3 with image from Kim et al., 2013
axis shortened, abnormal WT + MO2-bbs1 standard conditions Fig. 4 with image from Kim et al., 2013
Kupffer's vesicle decreased size, abnormal WT + MO2-bbs1 standard conditions Fig. 3,  text only from Tayeh et al., 2008
Kupffer's vesicle aplastic, abnormal WT + MO2-bbs1 standard conditions text only from Tayeh et al., 2008
eye decreased size, abnormal WT + MO2-bbs1 standard conditions Fig. S8 with image from Kim et al., 2013
pronephric tubule cilium increased length, abnormal WT + MO2-bbs1 standard conditions Fig. 7 with image from Kim et al., 2013
determination of left/right symmetry process quality, abnormal WT + MO2-bbs1 standard conditions Fig. 5 with image,  Fig. S5 with image from Kim et al., 2013
heart looping disrupted, abnormal WT + MO2-bbs1 standard conditions text only from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO2-bbs1 chemical treatment: (R)-adrenaline text only from Tayeh et al., 2008
retina layer formation process quality, abnormal WT + MO2-bbs1 standard conditions Fig. S8 with image from Kim et al., 2013
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO2-bbs1 standard conditions Fig. S5 with image from Kim et al., 2013
somite broad, abnormal WT + MO2-bbs1 standard conditions Fig. 4 with image from Kim et al., 2013
olfactory pit cilium decreased mobility, abnormal hsc5Tg + MO2-bbs1 standard conditions Fig. SMovie 11 from Kim et al., 2013
cloaca cilium decreased mobility, abnormal hsc5Tg + MO2-bbs1 standard conditions Fig. SMovie 6 from Kim et al., 2013
cilium movement process quality, abnormal hsc5Tg + MO2-bbs1 standard conditions Fig. SMovie 5,  Fig. SMovie 6,  Fig. SMovie 11,  Fig. SMovie4 from Kim et al., 2013
pronephric tubule cilium decreased mobility, abnormal hsc5Tg + MO2-bbs1 standard conditions Fig. SMovie 5,  Fig. SMovie4 from Kim et al., 2013
pronephros cystic, abnormal li1Tg + MO2-bbs1 standard conditions Fig. 3 with image,  Fig. 6 with image from Kim et al., 2013
Kupffer's vesicle decreased size, abnormal WT + MO1-arl6 + MO2-bbs1 standard conditions Fig. 2 from Tayeh et al., 2008
scapulocoracoid increased thickness, abnormal WT + MO1-arl6 + MO2-bbs1 standard conditions text only from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO1-arl6 + MO2-bbs1 chemical treatment: (R)-adrenaline Fig. 2 from Tayeh et al., 2008
Kupffer's vesicle morphology, abnormal WT + MO1-bbip1 + MO2-bbs1 standard conditions Fig. 2 with image from Loktev et al., 2008
Kupffer's vesicle development disrupted, abnormal WT + MO1-bbip1 + MO2-bbs1 standard conditions Fig. 2 with image from Loktev et al., 2008
melanosome transport delayed, abnormal WT + MO1-bbs2 + MO2-bbs1 chemical treatment: (R)-adrenaline Fig. 2 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal WT + MO1-bbs2 + MO2-bbs1 standard conditions Fig. 2 from Tayeh et al., 2008
embryonic pectoral fin morphogenesis disrupted, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 4 from Tayeh et al., 2008
embryonic pattern specification disrupted, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 4 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO1-bbs7 + MO2-bbs1 chemical treatment: (R)-adrenaline Fig. 3 from Tayeh et al., 2008
scapulocoracoid increased size, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 5 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO1-bbs7 + MO2-bbs1 chemical treatment: (R)-adrenaline Fig. 2 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 2,  Fig. 3 from Tayeh et al., 2008
scapulocoracoid morphology, abnormal WT + MO1-bbs7 + MO2-bbs1 standard conditions Fig. 5 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO2-bbs1 + MO2-bbs4 chemical treatment: (R)-adrenaline Fig. 2 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal WT + MO2-bbs1 + MO2-bbs4 standard conditions Fig. 2 from Tayeh et al., 2008
Kupffer's vesicle decreased size, abnormal WT + MO2-bbs1 + MO2-mkks standard conditions Fig. 2 from Tayeh et al., 2008
melanosome transport delayed, abnormal WT + MO2-bbs1 + MO2-mkks chemical treatment: (R)-adrenaline Fig. 2 from Tayeh et al., 2008
cloaca cilium decreased mobility, abnormal hsc5Tg + MO1-glis2b + MO2-bbs1 standard conditions Fig. SMovie 22 from Kim et al., 2013
cilium movement process quality, abnormal hsc5Tg + MO1-glis2b + MO2-bbs1 standard conditions Fig. SMovie 20,  Fig. SMovie 21,  Fig. SMovie 22 from Kim et al., 2013
pronephric tubule cilium decreased mobility, abnormal hsc5Tg + MO1-glis2b + MO2-bbs1 standard conditions Fig. SMovie 20,  Fig. SMovie 21 from Kim et al., 2013
pronephros cystic, abnormal li1Tg + MO1-glis2b + MO2-bbs1 standard conditions Fig. 6 with image from Kim et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.