Morpholino

MO1-casp3a

ID

ZDB-MRPHLNO-081016-1

Name

MO1-casp3a

Previous Names

caspase-MO (1)

Target

casp3a (1)

Sequence

5' - TTGCGTCCACACAGTCTCCGTTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-casp3a

Expressed Gene	Anatomy	Figures
casp3a	(not) whole organism	Fig. 11 from Yamashita et al., 2008

Phenotype

Phenotype resulting from MO1-casp3a

Phenotype	Fish	Figures
epiboly involved in gastrulation with mouth forming second arrested, abnormal	WT + MO1-casp3a	text only from Yamashita et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal	WT + MO1-casp3a	Fig. 11 from Yamashita et al., 2008
retinal ganglion cell axon physical object quality, abnormal	WT + MO1-casp3a	Fig. 1 from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal	WT + MO1-casp3a	Fig. 1 , Fig. 4 from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury occurrence, abnormal	WT + MO1-casp3a	Fig. 4 from Campbell et al., 2013
retinal ganglion cell cysteine-type endopeptidase activity decreased occurrence, abnormal	WT + MO1-casp3a	Fig. 1 from Campbell et al., 2013
retinal ganglion cell neuron remodeling decreased process quality, abnormal	WT + MO1-casp3a	Fig. 4 from Campbell et al., 2013
whole organism wholly dorsalized, abnormal	WT + MO1-casp3a	Fig. 11 from Yamashita et al., 2008

Phenotype of all Fish created by or utilizing MO1-casp3a

Phenotype	Fish	Conditions	Figures
retinal ganglion cell axon physical object quality, abnormal	WT + MO1-casp3a	standard conditions	Fig. 1 from Campbell et al., 2013
retinal ganglion cell cysteine-type endopeptidase activity decreased occurrence, abnormal	WT + MO1-casp3a	standard conditions	Fig. 1 from Campbell et al., 2013
epiboly involved in gastrulation with mouth forming second disrupted, abnormal	WT + MO1-casp3a	standard conditions	Fig. 11 from Yamashita et al., 2008
epiboly involved in gastrulation with mouth forming second arrested, abnormal	WT + MO1-casp3a	standard conditions	text only from Yamashita et al., 2008
retinal ganglion cell collateral sprouting in absence of injury occurrence, abnormal	WT + MO1-casp3a	standard conditions	Fig. 4 from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal	WT + MO1-casp3a	standard conditions	Fig. 1 , Fig. 4 from Campbell et al., 2013
whole organism wholly dorsalized, abnormal	WT + MO1-casp3a	standard conditions	Fig. 11 from Yamashita et al., 2008
retinal ganglion cell neuron remodeling decreased process quality, abnormal	WT + MO1-casp3a	standard conditions	Fig. 4 from Campbell et al., 2013
optic tectum microglial cell decreased amount, abnormal	hdb2Tg + MO1-casp3a	chemical treatment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 2 from Casano et al., 2016
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal	robo2^ti272z/+ + MO1-casp3a	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal	robo2^ti272z/+ + MO1-casp3a	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal	robo2^ti272z/+ + MO1-casp3a	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal	robo2^ti272z/+ + MO1-casp3a	standard conditions	Fig. 6 from Campbell et al., 2013
epiboly involved in gastrulation with mouth forming second arrested, abnormal	zf111Tg/+ + MO1-casp3a	standard conditions	text only from Yamashita et al., 2008
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal	WT + MO1-casp3a + MO1-slit1a	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal	WT + MO1-casp3a + MO1-slit1a	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell neuron remodeling decreased process quality, abnormal	WT + MO1-casp3a + MO1-slit1a	standard conditions	Fig. 8 from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal	WT + MO1-casp3a + MO1-slit1a	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal	WT + MO1-casp3a + MO1-slit1a	standard conditions	Fig. 6 from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury occurrence, abnormal	WT + MO1-casp3a + MO1-slit1a	standard conditions	Fig. 8 from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal	WT + MO1-casp3a + MO1-slit1a	standard conditions	Fig. 8 from Campbell et al., 2013
brain apoptotic process decreased occurrence, abnormal	WT + MO1-casp3a + MO1-spi1b	chemical treatment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 2 from Casano et al., 2016
retinal ganglion cell neuron remodeling decreased process quality, abnormal	WT + MO1-casp3a + MO3-robo2	standard conditions	Fig. 8 from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury occurrence, abnormal	WT + MO1-casp3a + MO3-robo2	standard conditions	Fig. 8 from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal	WT + MO1-casp3a + MO3-robo2	standard conditions	Fig. 8 from Campbell et al., 2013
microglial cell size, ameliorated	slc37a2^{t30301/t30301}; zf148Tg; zf149Tg + MO1-casp3a	chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 2 from Villani et al., 2019
brain apoptotic process decreased rate, abnormal	slc37a2^{t30301/t30301}; zf148Tg; zf149Tg + MO1-casp3a	chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 2 from Villani et al., 2019
microglial cell phagocytic vesicle diameter, ameliorated	slc37a2^{t30301/t30301}; zf148Tg; zf149Tg + MO1-casp3a	chemical treatment by environment: Z-Val-Ala-Asp(OMe)-CH2F	Fig. 2 from Villani et al., 2019

Citations