Morpholino
MO1-pou5f3
- ID
- ZDB-MRPHLNO-081015-1
- Name
- MO1-pou5f3
- Previous Names
-
- MO-pou2 (1)
- MO1-pou5f1
- Target
- Sequence
-
5' - CGCTCTCTCCGTCATCTTTCCGCTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pou5f3
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| aicda |
Fig. 3 
from Rai et al., 2010 |
|
| gadd45ab |
Fig. 3
from Rai et al., 2010 |
|
| hoxb1b |
Fig. 5
from Dong et al., 2017 |
|
| mbd4 |
Fig. 3
from Rai et al., 2010 |
|
| znfl1c |
Fig. 5
from Dong et al., 2017 |
|
| znfl1g |
Fig. 5
from Dong et al., 2017 |
|
| znfl1l |
Fig. 5
from Dong et al., 2017 |
|
| znfl1h |
Fig. 5
from Dong et al., 2017 |
|
| znfl1b |
Fig. 5
from Dong et al., 2017 |
|
| znfl1j |
Fig. 5
from Dong et al., 2017 |
|
| znfl1i |
Fig. 5
from Dong et al., 2017 |
|
| znfl1k |
Fig. 5
from Dong et al., 2017 |
|
| znfl1 |
Fig. 5
from Dong et al., 2017 |
Phenotype
Phenotype resulting from MO1-pou5f3
Phenotype of all Fish created by or utilizing MO1-pou5f3
Citations