Morpholino

MO3-myf6

ID

ZDB-MRPHLNO-080707-4

Name

MO3-myf6

Previous Names

Target

Sequence

5' - ATTAATAAAGGGACTAAGACGACAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is a splice blocking morpholino that targets myf6.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-myf6

Expressed Gene	Anatomy	Figures
actc1b	somite	Fig. 4 from Wang et al., 2008
alcama	secondary motor neuron axon somite	Fig. 6 from Wang et al., 2008
tnnt2c	somite	Fig. 4 from Wang et al., 2008
tnnt3b	somite	Fig. 4 from Wang et al., 2008

Phenotype

Phenotype resulting from MO3-myf6

Phenotype	Fish	Figures
axonogenesis disrupted, abnormal	WT + MO3-myf6	Fig. 6 from Wang et al., 2008
somite U-shaped, abnormal	WT + MO3-myf6	Fig. 4 from Wang et al., 2008
somite myofibril misaligned with somite myofibril, abnormal	WT + MO3-myf6	Fig. 3 , Fig. 4 from Wang et al., 2008
trunk curved ventral, abnormal	WT + MO3-myf6	Fig. 2 from Wang et al., 2008

Phenotype of all Fish created by or utilizing MO3-myf6

Phenotype	Fish	Conditions	Figures
axonogenesis disrupted, abnormal	WT + MO2-myf6 + MO3-myf6	standard conditions	Fig. 6 from Wang et al., 2008
primary motor neuron axon morphology, abnormal	WT + MO2-myf6 + MO3-myf6	standard conditions	Fig. 5 from Wang et al., 2008
somite U-shaped, abnormal	WT + MO2-myf6 + MO3-myf6	standard conditions	Fig. 3 , Fig. 4 from Wang et al., 2008
somite border amorphous, abnormal	WT + MO2-myf6 + MO3-myf6	standard conditions	Fig. 2 , Fig. 3 from Wang et al., 2008
somite myofibril misaligned with somite myofibril, abnormal	WT + MO2-myf6 + MO3-myf6	standard conditions	Fig. 3 , Fig. 4 from Wang et al., 2008
trunk curved ventral, abnormal	WT + MO2-myf6 + MO3-myf6	standard conditions	Fig. 2 from Wang et al., 2008
trunk curved ventral, abnormal	WT + MO3-myf6	standard conditions	Fig. 2 from Wang et al., 2008
somite myofibril misaligned with somite myofibril, abnormal	WT + MO3-myf6	standard conditions	Fig. 3 , Fig. 4 from Wang et al., 2008
axonogenesis disrupted, abnormal	WT + MO3-myf6	standard conditions	Fig. 6 from Wang et al., 2008
somite U-shaped, abnormal	WT + MO3-myf6	standard conditions	Fig. 4 from Wang et al., 2008

Citations