Morpholino

MO2-tfap2c

ID
ZDB-MRPHLNO-080220-1
Name
MO2-tfap2c
Previous Names
  • tfap2c e3i3
Target
Sequence
5' - TCTGACATCAACTCACCTGAACATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a splice blocking morpholino designed against the exon 3 splice donor site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tfap2c
Phenotype
Phenotype resulting from MO2-tfap2c
No data available
Phenotype of all Fish created by or utilizing MO2-tfap2c
Phenotype Fish Conditions Figures
retina malformed, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
lens aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
neuromast hair cell absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
whole organism morphology, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Van Otterloo et al., 2012
neural crest cell development disrupted, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 5 with image from Van Otterloo et al., 2012
enteric nervous system neuron absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
whole organism lacks all parts of type melanocyte, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Van Otterloo et al., 2012
Rohon-Beard neuron distributed, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 6 with image from Li et al., 2007
head edematous, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
whole organism curved ventral, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
post-vent region decreased length, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
cranial ganglion perineuronal satellite cell absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
cranial ganglion absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
median fin fold aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
Rohon-Beard neuron decreased amount, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 6 with image from Li et al., 2007
olfactory placode aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
sympathetic nervous system neuron absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
otic vesicle decreased size, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
pectoral fin aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 3 with image from Li et al., 2007
melanocyte absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with imageFig. 3 with image from Li et al., 2007
extension aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
otolith organ decreased amount, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 2 with image from Li et al., 2007
dorsal root ganglion absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
hair cell absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
lateral line system myelinating Schwann cell absent, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 4 with image from Li et al., 2007
pharyngeal arch cartilage aplastic, abnormal tfap2ats213/ts213 + MO2-tfap2c standard conditions Fig. 3 with image from Li et al., 2007
anterior lateral line aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
lens placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
olfactory field aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
post-vent region decreased length, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
extension aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
adenohypophyseal placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
trigeminal placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
ectodermal placode development decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
olfactory placode development decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic placode aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
melanocyte absent, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
olfactory pit aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic placode formation decreased occurrence, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
lens aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
otic vesicle hypoplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with imageFig. 5 with image from Bhat et al., 2013
epibranchial ganglion aplastic, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 1 with image from Bhat et al., 2013
neural crest cell development disrupted, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Van Otterloo et al., 2012
melanocyte decreased amount, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
whole organism curved ventral, abnormal WT + MO2-tfap2c + MO4-tfap2a standard conditions Fig. S1 with image from Li et al., 2007
lens morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
olfactory pit morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
Citations