Morpholino

MO1-dmrt2a

ID
ZDB-MRPHLNO-070815-1
Name
MO1-dmrt2a
Previous Names
  • Dmrt2a MO (1)
  • MO1-dmrt2
  • terra-MO1 (1)
Target
Sequence
5' - AGATCCGTCATTTTCTGGCCGCGTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dmrt2a
Expressed Gene Anatomy Figures
cxcl12b Fig. 10 from Pinto et al., 2018
cyp1a Fig. 10 from Pinto et al., 2018
dlc Fig. 1,  Fig. S4 from Saúde et al., 2005
dmrt2a Fig. 10 from Pinto et al., 2018
dmrt2b Fig. 2 with image from Lu et al., 2017
etsrp Fig. 10 from Pinto et al., 2018
foxc1a Fig. 10 from Pinto et al., 2018
foxc1b Fig. 10 from Pinto et al., 2018
foxj1b Fig. 10 from Pinto et al., 2018
her1 Fig. 1 from Saúde et al., 2005
her7 Fig. 1 from Saúde et al., 2005
myod1 Fig. 8 with image from Pinto et al., 2018
Fig. 2 with image from Lu et al., 2017
pitx2 Fig. 2 from Saúde et al., 2005
pxdc1b Fig. 10 from Pinto et al., 2018
shha Fig. 2 from Saúde et al., 2005
spaw Fig. 8 with image from Pinto et al., 2018
Fig. 2 from Saúde et al., 2005
tbxta Fig. 2 from Saúde et al., 2005
Phenotype
Phenotype resulting from MO1-dmrt2a
Phenotype Fish Figures
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-dmrt2a Fig. S2 with image from Matsui et al., 2012
determination of left/right symmetry disrupted, abnormal WT + MO1-dmrt2a Fig. 1,  Fig. 2,  Fig. S4 from Saúde et al., 2005
embryonic heart tube left/right pattern formation disrupted, abnormal WT + MO1-dmrt2a Fig. S2 with image from Matsui et al., 2012
heart jogging disrupted, abnormal WT + MO1-dmrt2a Fig. S2 with image from Matsui et al., 2012
lateral mesoderm right side spaw expression mislocalised, abnormal TU + MO1-dmrt2a Fig. 8 with image from Pinto et al., 2018
lateral plate mesoderm asymmetrical, abnormal WT + MO1-dmrt2a Fig. 2 from Saúde et al., 2005
left/right pattern formation process quality, abnormal TU + MO1-dmrt2a Fig. 8 with image from Pinto et al., 2018
somite asymmetrical, abnormal WT + MO1-dmrt2a Fig. S2 with image from Matsui et al., 2012
Fig. 1,  Fig. S4 from Saúde et al., 2005
somite foxc1a expression decreased amount, abnormal TU + MO1-dmrt2a Fig. 10 from Pinto et al., 2018
somite etsrp expression increased amount, abnormal TU + MO1-dmrt2a Fig. 10 from Pinto et al., 2018
somite foxc1b expression increased amount, abnormal TU + MO1-dmrt2a Fig. 10 from Pinto et al., 2018
somite pxdc1b expression increased amount, abnormal TU + MO1-dmrt2a Fig. 10 from Pinto et al., 2018
somite dmrt2a expression increased amount, abnormal TU + MO1-dmrt2a Fig. 10 from Pinto et al., 2018
somite cxcl12b expression increased amount, abnormal TU + MO1-dmrt2a Fig. 10 from Pinto et al., 2018
somite foxj1b expression increased amount, abnormal TU + MO1-dmrt2a Fig. 10 from Pinto et al., 2018
somite myod1 expression spatial pattern, abnormal TU + MO1-dmrt2a Fig. 8 with image from Pinto et al., 2018
trunk curved ventral, abnormal AB + MO1-dmrt2a Fig. 1 with image from Lu et al., 2017
trunk decreased length, abnormal AB + MO1-dmrt2a Fig. 1 with image from Lu et al., 2017
whole organism myod1 expression decreased amount, abnormal AB + MO1-dmrt2a Fig. 2 with image from Lu et al., 2017
whole organism dmrt2b expression increased amount, abnormal AB + MO1-dmrt2a Fig. 2 with image from Lu et al., 2017
whole organism posterior region cyp1a expression decreased amount, abnormal TU + MO1-dmrt2a Fig. 10 from Pinto et al., 2018
Phenotype of all Fish created by or utilizing MO1-dmrt2a
Phenotype Fish Conditions Figures
whole organism dmrt2b expression increased amount, abnormal AB + MO1-dmrt2a standard conditions Fig. 2 with image from Lu et al., 2017
trunk decreased length, abnormal AB + MO1-dmrt2a standard conditions Fig. 1 with image from Lu et al., 2017
whole organism myod1 expression decreased amount, abnormal AB + MO1-dmrt2a standard conditions Fig. 2 with image from Lu et al., 2017
trunk curved ventral, abnormal AB + MO1-dmrt2a standard conditions Fig. 1 with image from Lu et al., 2017
somite foxc1a expression decreased amount, abnormal TU + MO1-dmrt2a standard conditions Fig. 10 from Pinto et al., 2018
somite cxcl12b expression increased amount, abnormal TU + MO1-dmrt2a standard conditions Fig. 10 from Pinto et al., 2018
left/right pattern formation process quality, abnormal TU + MO1-dmrt2a standard conditions Fig. 8 with image from Pinto et al., 2018
whole organism posterior region cyp1a expression decreased amount, abnormal TU + MO1-dmrt2a standard conditions Fig. 10 from Pinto et al., 2018
somite etsrp expression increased amount, abnormal TU + MO1-dmrt2a standard conditions Fig. 10 from Pinto et al., 2018
somite myod1 expression spatial pattern, abnormal TU + MO1-dmrt2a standard conditions Fig. 8 with image from Pinto et al., 2018
lateral mesoderm right side spaw expression mislocalised, abnormal TU + MO1-dmrt2a standard conditions Fig. 8 with image from Pinto et al., 2018
somite dmrt2a expression increased amount, abnormal TU + MO1-dmrt2a standard conditions Fig. 10 from Pinto et al., 2018
somite foxc1b expression increased amount, abnormal TU + MO1-dmrt2a standard conditions Fig. 10 from Pinto et al., 2018
somite foxj1b expression increased amount, abnormal TU + MO1-dmrt2a standard conditions Fig. 10 from Pinto et al., 2018
somite pxdc1b expression increased amount, abnormal TU + MO1-dmrt2a standard conditions Fig. 10 from Pinto et al., 2018
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-dmrt2a standard conditions Fig. S2 with image from Matsui et al., 2012
determination of left/right symmetry disrupted, abnormal WT + MO1-dmrt2a standard conditions Fig. 1,  Fig. 2,  Fig. S4 from Saúde et al., 2005
somite asymmetrical, abnormal WT + MO1-dmrt2a standard conditions Fig. S2 with image from Matsui et al., 2012
Fig. 1,  Fig. S4 from Saúde et al., 2005
lateral plate mesoderm asymmetrical, abnormal WT + MO1-dmrt2a standard conditions Fig. 2 from Saúde et al., 2005
heart jogging disrupted, abnormal WT + MO1-dmrt2a standard conditions Fig. S2 with image from Matsui et al., 2012
embryonic heart tube left/right pattern formation disrupted, abnormal WT + MO1-dmrt2a standard conditions Fig. S2 with image from Matsui et al., 2012
embryonic heart tube left/right pattern formation disrupted, abnormal WT + MO1-dmrt2a + MO3-dmrt2a standard conditions Fig. 3 with image from Matsui et al., 2012
somite asymmetrical, abnormal WT + MO1-dmrt2a + MO3-dmrt2a standard conditions Fig. 3 with image from Matsui et al., 2012
heart jogging disrupted, abnormal WT + MO1-dmrt2a + MO3-dmrt2a standard conditions Fig. 3 with image from Matsui et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.