Morpholino

MO1-smad1

ID
ZDB-MRPHLNO-070608-3
Name
MO1-smad1
Previous Names
None
Target
Sequence
5' - AGGAAAAGAGTGAGGTGACATTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smad1
Expressed Gene Anatomy Figures
gata1a Fig. 4,  Fig. 6 from McReynolds et al., 2007
gata2a Fig. 3 from Dee et al., 2007
Fig. 4 from McReynolds et al., 2007
hbbe3 Fig. 3 from McReynolds et al., 2007
lcp1 Fig. 6 from McReynolds et al., 2007
lmo2 Fig. 4,  Fig. 6 from McReynolds et al., 2007
mpx Fig. 6 from McReynolds et al., 2007
myb Fig. 6 from McReynolds et al., 2007
pax2a Fig. 5 from McReynolds et al., 2007
runx1 Fig. 6 from McReynolds et al., 2007
sox2 Fig. 3 from Dee et al., 2007
sox3 Fig. 3 from Dee et al., 2007
spi1b Fig. 4,  Fig. 6 from McReynolds et al., 2007
tal1 Fig. 4 from McReynolds et al., 2007
tbxta Fig. 5 from McReynolds et al., 2007
Phenotype
Phenotype resulting from MO1-smad1
Phenotype Fish Figures
brain morphology, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
cloacal chamber cellular quality, abnormal WT + MO1-smad1 Fig. s4 with image from Laux et al., 2011
ectodermal cell fate commitment disrupted, abnormal WT + MO1-smad1 Fig. 3 from Dee et al., 2007
endoderm morphology, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
endoderm formation disrupted, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
epiphysis cellular quality, abnormal WT + MO1-smad1 Fig. T1 from Laux et al., 2011
extension decreased length, abnormal pt510Tg + MO1-smad1 Fig. 4 with image from Laux et al., 2011
extension morphology, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
heart cellular quality, abnormal WT + MO1-smad1 Fig. T1 from Laux et al., 2011
heart shape, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
heart looping arrested, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
hypothalamus cellular quality, abnormal pt510Tg + MO1-smad1 Fig. 4 with image from Laux et al., 2011
median fin fold cellular quality, abnormal WT + MO1-smad1 Fig. s4 with image from Laux et al., 2011
neuroectoderm degenerate, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
notochord increased width, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
nucleate erythrocyte increased amount, abnormal sd2Tg + MO1-smad1 Fig. 3 from McReynolds et al., 2007
otic placode decreased size, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
pectoral fin cellular quality, abnormal pt510Tg + MO1-smad1 Fig. 4 with image from Laux et al., 2011
pharyngeal arch cellular quality, abnormal WT + MO1-smad1 Fig. T1 from Laux et al., 2011
retina dorsal region cellular quality, abnormal pt510Tg + MO1-smad1 Fig. 4 with image from Laux et al., 2011
somite cellular quality, abnormal WT + MO1-smad1 Fig. s4 with image,  Fig. T1 from Laux et al., 2011
stomodeum cellular quality, abnormal pt510Tg + MO1-smad1 Fig. 4 with image from Laux et al., 2011
tail bud cellular quality, abnormal WT + MO1-smad1 Fig. T1 from Laux et al., 2011
whole organism increased length, abnormal WT + MO1-smad1 Fig. 2 from McReynolds et al., 2007
whole organism ventralized, abnormal WT + MO1-smad1 Fig 4 with image from Watterston et al., 2019
whole organism wholly dorsalized, abnormal WT + MO1-smad1 text only from Dee et al., 2007
Phenotype of all Fish created by or utilizing MO1-smad1
Phenotype Fish Conditions Figures
endoderm formation disrupted, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
neuroectoderm degenerate, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
extension morphology, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
epiphysis cellular quality, abnormal WT + MO1-smad1 standard conditions Fig. T1 from Laux et al., 2011
heart cellular quality, abnormal WT + MO1-smad1 standard conditions Fig. T1 from Laux et al., 2011
brain morphology, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
pharyngeal arch cellular quality, abnormal WT + MO1-smad1 standard conditions Fig. T1 from Laux et al., 2011
otic placode decreased size, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
notochord increased width, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
median fin fold cellular quality, abnormal WT + MO1-smad1 standard conditions Fig. s4 with image from Laux et al., 2011
heart looping arrested, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
whole organism wholly dorsalized, abnormal WT + MO1-smad1 standard conditions text only from Dee et al., 2007
ectodermal cell fate commitment disrupted, abnormal WT + MO1-smad1 standard conditions Fig. 3 from Dee et al., 2007
cloacal chamber cellular quality, abnormal WT + MO1-smad1 standard conditions Fig. s4 with image from Laux et al., 2011
endoderm morphology, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
whole organism ventralized, abnormal WT + MO1-smad1 control Fig 4 with image from Watterston et al., 2019
somite cellular quality, abnormal WT + MO1-smad1 standard conditions Fig. s4 with image,  Fig. T1 from Laux et al., 2011
tail bud cellular quality, abnormal WT + MO1-smad1 standard conditions Fig. T1 from Laux et al., 2011
heart shape, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
whole organism increased length, abnormal WT + MO1-smad1 standard conditions Fig. 2 from McReynolds et al., 2007
hypothalamus cellular quality, abnormal pt510Tg + MO1-smad1 standard conditions Fig. 4 with image from Laux et al., 2011
pectoral fin cellular quality, abnormal pt510Tg + MO1-smad1 standard conditions Fig. 4 with image from Laux et al., 2011
stomodeum cellular quality, abnormal pt510Tg + MO1-smad1 standard conditions Fig. 4 with image from Laux et al., 2011
extension decreased length, abnormal pt510Tg + MO1-smad1 standard conditions Fig. 4 with image from Laux et al., 2011
retina dorsal region cellular quality, abnormal pt510Tg + MO1-smad1 standard conditions Fig. 4 with image from Laux et al., 2011
nucleate erythrocyte increased amount, abnormal sd2Tg + MO1-smad1 standard conditions Fig. 3 from McReynolds et al., 2007
axial blood vessel ephb4a expression decreased amount, abnormal WT + MO1-smad1 + MO3-smad5 control Fig. S8 with image from Neal et al., 2019
neuroectoderm degenerate, abnormal WT + MO1-smad1 + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
dorsal aorta efnb2a expression decreased amount, abnormal WT + MO1-smad1 + MO3-smad5 control Fig. S8 with image from Neal et al., 2019
post-vent region increased curvature, abnormal WT + MO1-smad1 + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
axial blood vessel dll4 expression decreased amount, abnormal WT + MO1-smad1 + MO3-smad5 control Fig. S8 with image from Neal et al., 2019
whole organism dead, abnormal WT + MO1-smad1 + MO3-smad5 standard conditions Fig. 2 from McReynolds et al., 2007
whole organism ventralized, ameliorated WT + MO1-mir26a + MO1-smad1 control Fig 4 with image from Watterston et al., 2019
head hemorrhagic, ameliorated WT + MO1-mir26a + MO1-smad1 control Fig 4 with image from Watterston et al., 2019
posterior cardinal vein EGFP expression absent, abnormal lcr4Tg + MO1-smad1 + MO3-smad5 control Fig. 6 with image from Neal et al., 2019
intersegmental vessel EGFP expression absent, abnormal lcr4Tg + MO1-smad1 + MO3-smad5 control Fig. 6 with image from Neal et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.