Morpholino

MO1-cyp26c1

ID
ZDB-MRPHLNO-070410-6
Name
MO1-cyp26c1
Previous Names
None
Target
Sequence
5' - AAACTCGGTTATCCTCACCTTGCGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets exon-3?intron-3 junction.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cyp26c1
Phenotype
Phenotype resulting from MO1-cyp26c1
No data available
Phenotype of all Fish created by or utilizing MO1-cyp26c1
Phenotype Fish Conditions Figures
heart edematous, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. S2 with image from Rydeen et al., 2014
pancreas mislocalised anteriorly, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas increased length, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas development process quality, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
hindbrain edematous, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 standard conditions Fig. S2 with image from Rydeen et al., 2014
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
whole organism mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
whole organism fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart fgf8a expression decreased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 4 with image from Rydeen et al., 2016
heart mmp9 expression increased amount, abnormal WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 5 with image from Rydeen et al., 2016
hindbrain edematous, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
atrium has fewer parts of type cardiac muscle cell, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 2 with image from Rydeen et al., 2014
heart edematous, abnormal WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. S2 with image from Rydeen et al., 2014
pancreas mislocalised anteriorly, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
hindbrain wholly posteriorized, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
vagal lobe distended, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with image from Hernandez et al., 2007
pancreas development process quality, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pharyngeal endoderm condensed, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with image from Hernandez et al., 2007
pancreas increased length, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
hindbrain wholly posteriorized, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. S4 with image from Hernandez et al., 2007
hindbrain morphology, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. 2 with image from Hernandez et al., 2007
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26c1 + MO1-dnd1 standard conditions Fig. S4 with image from Hernandez et al., 2007
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 5 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
whole organism myl7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 1 with imageFig. 5 with image from Rydeen et al., 2016
cardiac ventricle decreased size, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis process quality, ameliorated f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
whole organism myh7 expression decreased amount, abnormal f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
presumptive bulbus arteriosus ripply3 expression increased amount, abnormal fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1 standard conditions Fig 7 with image from Song et al., 2019
cell migration involved in heart formation process quality, abnormal fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch has extra parts of type blood vessel endothelial cell, abnormal fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE Fig. 5 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
cardiac muscle cell mislocalised, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 1 with imageFig. 5 with image from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac muscle cell circular, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium cell-cell junction ab1-ctnnb labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
ventricular myocardium bicellular tight junction ab1-tjp1 labeling spatial pattern, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle establishment of cell polarity decreased process quality, abnormal twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
endocardium has fewer parts of type endothelial cell, abnormal ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 7 with image from Rydeen et al., 2014
cranial vasculature has fewer parts of type endothelial cell, abnormal ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 standard conditions Fig. 7 with image from Rydeen et al., 2014
ventricular myocardium increased distance ventricular endocardium, abnormal ci5Tg; twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal ci5Tg; twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 3 with image from Rydeen et al., 2016
aortic arch 4 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
aortic arch 3 has extra parts of type blood vessel endothelial cell, abnormal fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 control Fig. 2 with image from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated pd3Tg; sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1 heat shock Fig. 4 with image from Rydeen et al., 2016
Citations