Morpholino

MO2-wnt8b

ID
ZDB-MRPHLNO-070116-1
Name
MO2-wnt8b
Previous Names
None
Target
Sequence
5' - AGGGAGACTTTTCTTCACCTTTCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt8b
Expressed Gene Anatomy Figures
ascl1a Fig. 7 with image from Lee et al., 2006
barhl2 Fig. 8 with image from Russek-Blum et al., 2008
dlx2a Fig. 7 with image from Lee et al., 2006
gfap Fig. 2,  Fig. 6 from Hofmeister et al., 2013
isl1a Fig. 7 with image from Lee et al., 2006
lef1 Fig. 1 with image from Lee et al., 2006
slc6a3 Fig. 8 with image,  Fig. 9 with image from Russek-Blum et al., 2008
slit2 Fig. 3,  Fig. 5 from Hofmeister et al., 2013
sox3 Fig. 7 with image from Lee et al., 2006
Phenotype
Phenotype resulting from MO2-wnt8b
Phenotype Fish Figures
anterior commissure has fewer parts of type anterior commissure axon, abnormal WT + MO2-wnt8b Fig. 2 from Hofmeister et al., 2013
anterior commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b Fig. 2,  Fig. 3 from Hofmeister et al., 2013
anterior commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b Fig. 2 from Hofmeister et al., 2013
brain morphology, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
diencephalon dopaminergic neuron increased amount, abnormal WT + MO2-wnt8b Fig. 8 with image,  Fig. 9 with image from Russek-Blum et al., 2008
eye decreased pigmentation, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
forebrain lacks all parts of type anterior commissure, abnormal WT + MO2-wnt8b Fig. 3 from Hofmeister et al., 2013
forebrain Roundabout signaling pathway involved in axon guidance increased process quality, abnormal WT + MO2-wnt8b Fig. 3 from Hofmeister et al., 2013
forebrain neuron differentiation disrupted, abnormal WT + MO2-wnt8b Fig. 7 with image from Lee et al., 2006
hypothalamus posterior side morphology, abnormal WT + MO2-wnt8b Fig. 1 with image,  Fig. 7 with image from Lee et al., 2006
hypothalamus development disrupted, abnormal WT + MO2-wnt8b Fig. 7 with image from Lee et al., 2006
pericardium edematous, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
post-vent region curved, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
post-vent region deformed, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
postoptic commissure decreased size, abnormal WT + MO2-wnt8b Fig. 3 from Hofmeister et al., 2013
postoptic commissure has fewer parts of type postoptic commissure axon, abnormal WT + MO2-wnt8b Fig. 2 from Hofmeister et al., 2013
postoptic commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b Fig. 2,  Fig. 3 from Hofmeister et al., 2013
postoptic commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b Fig. 2 from Hofmeister et al., 2013
Phenotype of all Fish created by or utilizing MO2-wnt8b
Phenotype Fish Conditions Figures
post-vent region deformed, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
brain morphology, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
post-vent region curved, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
eye decreased pigmentation, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
pericardium edematous, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
postoptic commissure decreased size, abnormal WT + MO2-wnt8b standard conditions Fig. 3 from Hofmeister et al., 2013
forebrain lacks all parts of type anterior commissure, abnormal WT + MO2-wnt8b standard conditions Fig. 3 from Hofmeister et al., 2013
anterior commissure has fewer parts of type anterior commissure axon, abnormal WT + MO2-wnt8b standard conditions Fig. 2 from Hofmeister et al., 2013
anterior commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b standard conditions Fig. 2,  Fig. 3 from Hofmeister et al., 2013
anterior commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b standard conditions Fig. 2 from Hofmeister et al., 2013
diencephalon dopaminergic neuron increased amount, abnormal WT + MO2-wnt8b standard conditions Fig. 8 with image,  Fig. 9 with image from Russek-Blum et al., 2008
hypothalamus development disrupted, abnormal WT + MO2-wnt8b standard conditions Fig. 7 with image from Lee et al., 2006
postoptic commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b standard conditions Fig. 2,  Fig. 3 from Hofmeister et al., 2013
forebrain Roundabout signaling pathway involved in axon guidance increased process quality, abnormal WT + MO2-wnt8b standard conditions Fig. 3 from Hofmeister et al., 2013
hypothalamus posterior side morphology, abnormal WT + MO2-wnt8b standard conditions Fig. 1 with image,  Fig. 7 with image from Lee et al., 2006
postoptic commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b standard conditions Fig. 2 from Hofmeister et al., 2013
postoptic commissure has fewer parts of type postoptic commissure axon, abnormal WT + MO2-wnt8b standard conditions Fig. 2 from Hofmeister et al., 2013
forebrain neuron differentiation disrupted, abnormal WT + MO2-wnt8b standard conditions Fig. 7 with image from Lee et al., 2006
diencephalon dopaminergic neuron decreased amount, abnormal fezf2m808/m808 + MO2-wnt8b standard conditions Fig. 9 with image from Russek-Blum et al., 2008
embryonic pattern specification disrupted, abnormal AB + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
hindbrain disorganized, abnormal AB + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
postoptic commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 6 from Hofmeister et al., 2013
postoptic commissure has fewer parts of type postoptic commissure axon, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 6 from Hofmeister et al., 2013
anterior commissure medial region lacks all parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 6 from Hofmeister et al., 2013
anterior commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5,  Fig. 6 from Hofmeister et al., 2013
forebrain Roundabout signaling pathway involved in axon guidance increased process quality, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5 from Hofmeister et al., 2013
postoptic commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5,  Fig. 6 from Hofmeister et al., 2013
postoptic commissure decreased size, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5 from Hofmeister et al., 2013
postoptic commissure axon defasciculated, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5 from Hofmeister et al., 2013
forebrain lacks all parts of type anterior commissure, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5 from Hofmeister et al., 2013
anterior commissure lacks all parts of type anterior commissure axon, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 6 from Hofmeister et al., 2013
radial glial cell cell projection irregular spatial pattern, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
embryonic pattern specification disrupted, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
rhombomere primary neuron crowded, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
radial glial cell cell projection tangled, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
axon guidance disrupted, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
hindbrain disorganized, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
rhombomere primary neuron disorganized, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
hindbrain commissure neuron absent, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.