Morpholino

MO1-foxe3

ID

ZDB-MRPHLNO-061215-1

Name

MO1-foxe3

Previous Names

foxe3 81-57 (1)

Target

foxe3 (1)

Sequence

5' - ACCTAAATTTGCCTAACTAAACGGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This is against 5' UTR of foxe3.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-foxe3

Expressed Gene	Anatomy	Figures
cryaa	lens	Fig. 9 , Fig. 10 from Shi et al., 2006
foxe3	whole organism	Fig. 5 , Fig. 11 from Shi et al., 2006
pcna	lens	Fig. 8 from Shi et al., 2006
pitx3	lens whole organism	Fig. 5 , Fig. 11 , Fig. 13 from Shi et al., 2006
rho	lens	Fig. 9 from Shi et al., 2006

Phenotype

Phenotype resulting from MO1-foxe3

Phenotype	Fish	Figures
cornea composition, abnormal	WT + MO1-foxe3	Fig. 9 from Shi et al., 2006
cornea nucleate quality, abnormal	WT + MO1-foxe3	Fig. 9 from Shi et al., 2006
eye decreased size, abnormal	WT + MO1-foxe3	Fig. 6 from Shi et al., 2006
lens malformed, abnormal	WT + MO1-foxe3	Fig. 7 from Shi et al., 2006
lens pigmented, abnormal	WT + MO1-foxe3	Fig. 7 , Fig. 9 from Shi et al., 2006
lens actin filament decreased amount, abnormal	WT + MO1-foxe3	Fig. 9 from Shi et al., 2006
lens actin filament spatial pattern, abnormal	WT + MO1-foxe3	Fig. 9 from Shi et al., 2006
lens cell disorganized, abnormal	WT + MO1-foxe3	Fig. 9 , Fig. 10 from Shi et al., 2006
lens cell poorly differentiated, abnormal	WT + MO1-foxe3	Fig. 9 , Fig. 10 from Shi et al., 2006
lens cell shape, abnormal	WT + MO1-foxe3	Fig. 9 from Shi et al., 2006
lens epithelial cell proliferation increased occurrence, abnormal	WT + MO1-foxe3	Fig. 8 from Shi et al., 2006
lens epithelium composition, abnormal	WT + MO1-foxe3	Fig. 7 , Fig. 9 from Shi et al., 2006
lens epithelium has extra parts of type epithelial cell nucleus, abnormal	WT + MO1-foxe3	Fig. 7 , Fig. 9 from Shi et al., 2006
lens epithelium has extra parts of type epithelial cell, abnormal	WT + MO1-foxe3	Fig. 8 from Shi et al., 2006
lens epithelium structure, abnormal	WT + MO1-foxe3	Fig. 7 from Shi et al., 2006
lens epithelium epithelial cell immature, abnormal	WT + MO1-foxe3	Fig. 7 from Shi et al., 2006
lens epithelium epithelial cell nucleate quality, abnormal	WT + MO1-foxe3	Fig. 7 from Shi et al., 2006
lens epithelium epithelial cell swollen, abnormal	WT + MO1-foxe3	Fig. 7 from Shi et al., 2006
lens epithelium nucleus disorganized, abnormal	WT + MO1-foxe3	Fig. 7 from Shi et al., 2006
lens epithelium nucleus increased size, abnormal	WT + MO1-foxe3	Fig. 7 from Shi et al., 2006
lens fiber cell differentiation disrupted, abnormal	WT + MO1-foxe3	Fig. 7 from Shi et al., 2006
lens fiber cell fate commitment disrupted, abnormal	WT + MO1-foxe3	Fig. 9 from Shi et al., 2006
pupil absent, abnormal	WT + MO1-foxe3	Fig. 6 from Shi et al., 2006
pupil decreased size, abnormal	WT + MO1-foxe3	Fig. 6 from Shi et al., 2006

Phenotype of all Fish created by or utilizing MO1-foxe3

Phenotype	Fish	Conditions	Figures
lens actin filament spatial pattern, abnormal	WT + MO1-foxe3	standard conditions	Fig. 9 from Shi et al., 2006
lens epithelial cell proliferation increased occurrence, abnormal	WT + MO1-foxe3	standard conditions	Fig. 8 from Shi et al., 2006
lens epithelium has extra parts of type epithelial cell nucleus, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 , Fig. 9 from Shi et al., 2006
lens pigmented, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 , Fig. 9 from Shi et al., 2006
cornea nucleate quality, abnormal	WT + MO1-foxe3	standard conditions	Fig. 9 from Shi et al., 2006
lens epithelium has extra parts of type epithelial cell, abnormal	WT + MO1-foxe3	standard conditions	Fig. 8 from Shi et al., 2006
lens actin filament decreased amount, abnormal	WT + MO1-foxe3	standard conditions	Fig. 9 from Shi et al., 2006
lens cell poorly differentiated, abnormal	WT + MO1-foxe3	standard conditions	Fig. 9 , Fig. 10 from Shi et al., 2006
lens fiber cell differentiation disrupted, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 from Shi et al., 2006
lens fiber cell fate commitment disrupted, abnormal	WT + MO1-foxe3	standard conditions	Fig. 9 from Shi et al., 2006
lens epithelium epithelial cell nucleate quality, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 from Shi et al., 2006
lens cell disorganized, abnormal	WT + MO1-foxe3	standard conditions	Fig. 9 , Fig. 10 from Shi et al., 2006
cornea composition, abnormal	WT + MO1-foxe3	standard conditions	Fig. 9 from Shi et al., 2006
lens epithelium nucleus disorganized, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 from Shi et al., 2006
lens epithelium epithelial cell swollen, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 from Shi et al., 2006
lens epithelium epithelial cell immature, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 from Shi et al., 2006
lens malformed, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 from Shi et al., 2006
eye decreased size, abnormal	WT + MO1-foxe3	standard conditions	Fig. 6 from Shi et al., 2006
pupil absent, abnormal	WT + MO1-foxe3	standard conditions	Fig. 6 from Shi et al., 2006
lens epithelium nucleus increased size, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 from Shi et al., 2006
lens cell shape, abnormal	WT + MO1-foxe3	standard conditions	Fig. 9 from Shi et al., 2006
lens epithelium structure, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 from Shi et al., 2006
pupil decreased size, abnormal	WT + MO1-foxe3	standard conditions	Fig. 6 from Shi et al., 2006
lens epithelium composition, abnormal	WT + MO1-foxe3	standard conditions	Fig. 7 , Fig. 9 from Shi et al., 2006

Citations