Morpholino

MO1-runx3

ID
ZDB-MRPHLNO-061127-5
Name
MO1-runx3
Previous Names
None
Target
Sequence
5' - TGCTCGGGTCTACGGGAATATGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-runx3
Expressed Gene Anatomy Figures
alcama Fig. 5 with image from Flores et al., 2006
egr1 Fig. 5 with image from Dalcq et al., 2012
fgfrl1a Fig. 5 with image from Flores et al., 2006
fsta Fig. 7 with image from Dalcq et al., 2012
nkx2.3 Fig. 5 with image from Dalcq et al., 2012
runx2b Fig. 5 with image from Dalcq et al., 2012
Fig. 5 with image from Flores et al., 2006
sox9b Fig. 5 with image from Dalcq et al., 2012
Phenotype
Phenotype resulting from MO1-runx3
Phenotype Fish Figures
ceratobranchial cartilage aplastic, abnormal WT + MO1-runx3 Fig. 5 with image from Dalcq et al., 2012
ceratohyal cartilage aplastic, abnormal WT + MO1-runx3 Fig. 5 with image from Dalcq et al., 2012
chondrocyte differentiation delayed, abnormal WT + MO1-runx3 Fig. 4 with image from Flores et al., 2006
cranial cartilage aplastic, abnormal WT + MO1-runx3 Fig. 6 with image from Dalcq et al., 2012
cranium decreased size, abnormal WT + MO1-runx3 Fig. 4 with image from Flores et al., 2006
hyosymplectic cartilage aplastic, abnormal WT + MO1-runx3 Fig. 5 with image from Dalcq et al., 2012
Meckel's cartilage aplastic, abnormal WT + MO1-runx3 Fig. 5 with image from Dalcq et al., 2012
neurocranium anterior region aplastic, abnormal WT + MO1-runx3 Fig. 5 with image from Dalcq et al., 2012
palatoquadrate cartilage aplastic, abnormal WT + MO1-runx3 Fig. 5 with image from Dalcq et al., 2012
splanchnocranium aplastic, abnormal WT + MO1-runx3 Fig. 5 with image,  Fig. 6 with image from Dalcq et al., 2012
Phenotype of all Fish created by or utilizing MO1-runx3
Phenotype Fish Conditions Figures
palatoquadrate cartilage aplastic, abnormal WT + MO1-runx3 standard conditions Fig. 5 with image from Dalcq et al., 2012
neurocranium anterior region aplastic, abnormal WT + MO1-runx3 standard conditions Fig. 5 with image from Dalcq et al., 2012
cranium decreased size, abnormal WT + MO1-runx3 standard conditions Fig. 4 with image from Flores et al., 2006
splanchnocranium aplastic, abnormal WT + MO1-runx3 standard conditions Fig. 5 with image,  Fig. 6 with image from Dalcq et al., 2012
ceratobranchial cartilage aplastic, abnormal WT + MO1-runx3 standard conditions Fig. 5 with image from Dalcq et al., 2012
cranial cartilage aplastic, abnormal WT + MO1-runx3 standard conditions Fig. 6 with image from Dalcq et al., 2012
hyosymplectic cartilage aplastic, abnormal WT + MO1-runx3 standard conditions Fig. 5 with image from Dalcq et al., 2012
Meckel's cartilage aplastic, abnormal WT + MO1-runx3 standard conditions Fig. 5 with image from Dalcq et al., 2012
ceratohyal cartilage aplastic, abnormal WT + MO1-runx3 standard conditions Fig. 5 with image from Dalcq et al., 2012
chondrocyte differentiation delayed, abnormal WT + MO1-runx3 standard conditions Fig. 4 with image from Flores et al., 2006
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.