Morpholino

MO1-hey2

ID
ZDB-MRPHLNO-060928-3
Name
MO1-hey2
Previous Names
  • grlMO (1)
Target
Sequence
5' - CGCGCAGGTACAGACACCAAAAACT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hey2
Expressed Gene Anatomy Figures
efnb2a Fig. 1 from Esser et al., 2018
ephb2a Fig. 3 with image from Chou et al., 2010
ephb4a Fig. 2 from Esser et al., 2018
flt4 Fig. 3 with image from Chou et al., 2010
hsd3b Fig. 7 with image from Liu et al., 2006
nr5a1a Fig. 3 with image from Chou et al., 2010
Phenotype
Phenotype resulting from MO1-hey2
Phenotype Fish Figures
artery absent, abnormal WT + MO1-hey2 Fig. 3 with image from Chou et al., 2010
blood circulation absent, abnormal WT + MO1-hey2 Fig. 3 with image from Chou et al., 2010
blood vessel morphogenesis disrupted, abnormal WT + MO1-hey2 Fig. 2 from Herbert et al., 2009
caudal artery efnb2a expression decreased amount, abnormal y1Tg + MO1-hey2 Fig. 1 from Esser et al., 2018
caudal artery efnb2a expression decreased distribution, abnormal y1Tg + MO1-hey2 Fig. 1 from Esser et al., 2018
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO1-hey2 Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO1-hey2 Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO1-hey2 Fig. 2 from Esser et al., 2018
dorsal aorta absent, abnormal WT + MO1-hey2 Fig. 3 with image from Chou et al., 2010
dorsal aorta aplastic, abnormal WT + MO1-hey2 Fig. 2 from Herbert et al., 2009
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-hey2 Fig. 3 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-hey2 Fig. 3 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-hey2 Fig. 3 with image from Chen et al., 2017
interrenal primordium centered, abnormal WT + MO1-hey2 Fig. 3 with image from Chou et al., 2010
intersegmental vessel absent, abnormal WT + MO1-hey2 Fig. 3 with image from Chou et al., 2010
posterior cardinal vein morphology, abnormal WT + MO1-hey2 Fig. 3 with image from Chou et al., 2010
pronephric glomerular capillary absent, abnormal WT + MO1-hey2 Fig. 3 with image from Chou et al., 2010
vein morphology, abnormal WT + MO1-hey2 Fig. 3 with image from Chou et al., 2010
Phenotype of all Fish created by or utilizing MO1-hey2
Phenotype Fish Conditions Figures
pronephric glomerular capillary absent, abnormal WT + MO1-hey2 standard conditions Fig. 3 with image from Chou et al., 2010
intersegmental vessel absent, abnormal WT + MO1-hey2 standard conditions Fig. 3 with image from Chou et al., 2010
dorsal aorta absent, abnormal WT + MO1-hey2 standard conditions Fig. 3 with image from Chou et al., 2010
artery absent, abnormal WT + MO1-hey2 standard conditions Fig. 3 with image from Chou et al., 2010
blood vessel morphogenesis disrupted, abnormal WT + MO1-hey2 standard conditions Fig. 2 from Herbert et al., 2009
vein morphology, abnormal WT + MO1-hey2 standard conditions Fig. 3 with image from Chou et al., 2010
dorsal aorta aplastic, abnormal WT + MO1-hey2 standard conditions Fig. 2 from Herbert et al., 2009
blood circulation absent, abnormal WT + MO1-hey2 standard conditions Fig. 3 with image from Chou et al., 2010
posterior cardinal vein morphology, abnormal WT + MO1-hey2 standard conditions Fig. 3 with image from Chou et al., 2010
interrenal primordium centered, abnormal WT + MO1-hey2 standard conditions Fig. 3 with image from Chou et al., 2010
caudal artery efnb2a expression decreased amount, abnormal y1Tg + MO1-hey2 standard conditions Fig. 1 from Esser et al., 2018
caudal artery ephb4a expression increased distribution, abnormal y1Tg + MO1-hey2 standard conditions Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased amount, abnormal y1Tg + MO1-hey2 standard conditions Fig. 2 from Esser et al., 2018
caudal vein plexus ephb4a expression increased distribution, abnormal y1Tg + MO1-hey2 standard conditions Fig. 2 from Esser et al., 2018
caudal artery efnb2a expression decreased distribution, abnormal y1Tg + MO1-hey2 standard conditions Fig. 1 from Esser et al., 2018
dorsal aorta anatomical region mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-hey2 control Fig. 3 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell decreased amount, abnormal s843Tg; uto5Tg + MO1-hey2 control Fig. 3 with image from Chen et al., 2017
dorsal aorta vascular associated smooth muscle cell mCherry expression absent, abnormal s843Tg; uto5Tg + MO1-hey2 control Fig. 3 with image from Chen et al., 2017
trunk blood circulation decreased occurrence, abnormal sox7hu5626/hu5626 + MO1-hey2 standard conditions Fig. 6 with image from Hermkens et al., 2015
blood circulation process quality, abnormal sox7hu5626/hu5626 + MO1-hey2 standard conditions Fig. 6 with image from Hermkens et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.