Morpholino

MO2-isl1a

ID
ZDB-MRPHLNO-060728-1
Name
MO2-isl1a
Previous Names
  • islet1E2 (1)
  • MO2-isl1
Target
Sequence
5' - TTAATCTGCGTTACCTGATGTAGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-isl1a
Phenotype
Phenotype resulting from MO2-isl1a
Phenotype of all Fish created by or utilizing MO2-isl1a
Phenotype Fish Conditions Figures
motor neuron axon mislocalised posteriorly, abnormal AB + MO2-isl1a + MO3-isl1a standard conditions Fig. 4 with image from Hutchinson et al., 2006
VeLD increased amount, abnormal AB + MO2-isl1a + MO3-isl1a standard conditions Fig. 4 with image from Hutchinson et al., 2006
Kolmer-Agduhr neuron increased amount, abnormal AB + MO2-isl1a + MO3-isl1a standard conditions Fig. 4 with image from Hutchinson et al., 2006
heart decreased functionality, abnormal WT + MO2-isl1a standard conditions Fig. 4 from Hoffmann et al., 2013
heart contraction disrupted, abnormal WT + MO2-isl1a standard conditions Fig. 4 from Hoffmann et al., 2013
blood accumulation pericardium, abnormal WT + MO2-isl1a standard conditions Fig. 4 from Hoffmann et al., 2013
heart contraction decreased occurrence, abnormal WT + MO2-isl1a standard conditions Fig. 4 from Hoffmann et al., 2013
sinus venosus bmp4 expression absent, abnormal WT + MO2-isl1a standard conditions Fig. 8 with image from Colombo et al., 2017
regulation of heart contraction disrupted, abnormal WT + MO2-isl1a standard conditions Fig. 4 from Hoffmann et al., 2013
pericardium edematous, abnormal WT + MO2-isl1a standard conditions Fig. 4 from Hoffmann et al., 2013
secondary motor neuron axon decreased amount, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 3 with image from Hutchinson et al., 2006
secondary motor neuron decreased amount, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 3 with image from Hutchinson et al., 2006
secondary motor neuron axon disorganized, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 3 with image from Hutchinson et al., 2006
MiP motor neuron axon absent, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 2 with image from Hutchinson et al., 2006
CaP motoneuron axon absent, abnormal WT + MO2-isl1a + MO3-isl1a standard conditions Fig. 2 with image from Hutchinson et al., 2006
sinus venosus bmp4 expression absent, abnormal nkx2.7vu413/vu413 + MO2-isl1a standard conditions Fig. 8 with image from Colombo et al., 2017
secondary motor neuron absent, abnormal WT + MO1-isl2a + MO2-isl1a + MO3-isl1a standard conditions Fig. 3 with image from Hutchinson et al., 2006
Citations