Morpholino

MO1-chn1

ID

ZDB-MRPHLNO-060501-1

Name

MO1-chn1

Previous Names

None

Target

Sequence

5' - GCCATTGCAGACAGTGATTCAGCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-chn1

Expressed Gene	Anatomy	Figures
bmp4	prechordal plate tail bud whole organism	Fig. 3, Fig. S8, Fig. S10 from Leskow et al., 2006
dlx3b	whole organism	Fig. S8 from Leskow et al., 2006
egr2b	presumptive rhombomere 3 presumptive rhombomere 5	Fig. 3 from Leskow et al., 2006
eve1	whole organism	Fig. S8 from Leskow et al., 2006
foxb1a	whole organism	Fig. S8 from Leskow et al., 2006
gata2a	whole organism	Fig. S8 from Leskow et al., 2006
gsc	whole organism	Fig. S8 from Leskow et al., 2006
myod1	paraxial mesoderm somite	Fig. 3 from Leskow et al., 2006
pax2a	midbrain hindbrain boundary neural keel midbrain hindbrain boundary neural plate midbrain hindbrain boundary neural rod	Fig. 3, Fig. S10 from Leskow et al., 2006
rac1a	whole organism	Fig. 2 from Leskow et al., 2006
shha	mesoderm presumptive dorsal mesoderm tail bud	Fig. 3, Fig. S8 from Leskow et al., 2006
tbxta	mesoderm notochord presumptive mesoderm tail bud	Fig. 3, Fig. S8, Fig. S10 from Leskow et al., 2006

Phenotype

Phenotype resulting from MO1-chn1

Phenotype	Fish	Figures
cranial nerve III decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	Fig. 4 from Zhang et al., 2023
cranial nerve III axon mislocalised, abnormal	WT + MO1-chn1	Fig. 5 from Clark et al., 2013
cranial nerve III axon extension process quality, abnormal	WT + MO1-chn1	Fig. 5 from Clark et al., 2013
cranial nerve IV decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	Fig. 4 from Zhang et al., 2023
cranial nerve V decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	Fig. 4 from Zhang et al., 2023
cranial nerve VI decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	Fig. 4 from Zhang et al., 2023
cranial nerve VIII decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	Fig. 4 from Zhang et al., 2023
cranial nerve X decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	Fig. 4 from Zhang et al., 2023
oculomotor nerve formation decreased process quality, abnormal	WT + MO1-chn1	Fig. 5 from Clark et al., 2013
optomotor response decreased process quality, abnormal	WT + MO1-chn1	Fig. T3 from Clark et al., 2013

Phenotype of all Fish created by or utilizing MO1-chn1

Phenotype	Fish	Conditions	Figures
cranial nerve III axon extension process quality, abnormal	WT + MO1-chn1	standard conditions	Fig. 5 from Clark et al., 2013
oculomotor nerve formation decreased process quality, abnormal	WT + MO1-chn1	standard conditions	Fig. 5 from Clark et al., 2013
optomotor response decreased process quality, abnormal	WT + MO1-chn1	standard conditions	Fig. T3 from Clark et al., 2013
cranial nerve III axon mislocalised, abnormal	WT + MO1-chn1	standard conditions	Fig. 5 from Clark et al., 2013
cranial nerve VI decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	standard conditions	Fig. 4 from Zhang et al., 2023
cranial nerve V decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	standard conditions	Fig. 4 from Zhang et al., 2023
cranial nerve VIII decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	standard conditions	Fig. 4 from Zhang et al., 2023
cranial nerve X decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	standard conditions	Fig. 4 from Zhang et al., 2023
cranial nerve IV decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	standard conditions	Fig. 4 from Zhang et al., 2023
cranial nerve III decreased size, abnormal	rw0Tg; vu19Tg + MO1-chn1	standard conditions	Fig. 4 from Zhang et al., 2023

Citations