Morpholino

MO1-ptger2a

ID
ZDB-MRPHLNO-060302-1
Name
MO1-ptger2a
Previous Names
  • ep2-MO1 (1)
  • MO1-ptger2l (1)
Target
Sequence
5' - GATGTTGGCATGTTTGAGAGCATGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation blocker targeted to 5'-UTR
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptger2a
Phenotype
Phenotype resulting from MO1-ptger2a
Phenotype of all Fish created by or utilizing MO1-ptger2a
Phenotype Fish Conditions Figures
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptger2a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule size, ameliorated TU + MO1-ptger2a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO1-ptger2a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression spatial pattern, ameliorated TU + MO1-ptger2a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptger2a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO1-ptger2a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule size, ameliorated TU + MO1-ptger2a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression spatial pattern, ameliorated TU + MO1-ptger2a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 4 with image from Poureetezadi et al., 2016
hematopoietic stem cell decreased amount, abnormal WT + MO1-ptger2a + MO2-ptger2a standard conditions Fig. S1 from North et al., 2007
exocrine pancreas size, ameliorated WT + MO1-ptger2a + MO2-ptger2a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger2a + MO2-ptger2a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO2-ptger2a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger2a + MO2-ptger2a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO2-ptger2a control Fig. 1 with image from Nissim et al., 2014
liver EGFP expression decreased distribution, abnormal as3Tg + MO1-ptger2a + MO2-ptger2a control Fig. 1 with image from Nissim et al., 2014
liver size, ameliorated as3Tg + MO1-ptger2a + MO2-ptger2a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver EGFP expression amount, ameliorated as3Tg + MO1-ptger2a + MO2-ptger2a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO1-ptger2a + MO1-ptgs1 standard conditions Fig. 4 with image from Poureetezadi et al., 2016
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated zf578Tg + MO1-ptger2a + MO1-ptgs2a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptgs2a control Fig. 2 with image from Nissim et al., 2014
Citations