Morpholino

MO2-vps33b

ID

ZDB-MRPHLNO-051216-2

Name

MO2-vps33b

Previous Names

Target

Sequence

5' - CTATACCATAACTCTGAACAAGACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-vps33b

No data available

Phenotype

Phenotype resulting from MO2-vps33b

Phenotype	Fish	Figures
bile ductule decreased amount, abnormal	WT + MO2-vps33b	Fig. 3 from Matthews et al., 2005
enterocyte cytoplasm composition, abnormal	WT + MO2-vps33b	Fig. 6 from Matthews et al., 2005
enterocyte Golgi stack dilated, abnormal	WT + MO2-vps33b	Fig. 6 from Matthews et al., 2005
intrahepatic bile duct decreased amount, abnormal	WT + MO2-vps33b	Fig. 3 from Matthews et al., 2005
intrahepatic bile duct sparse, abnormal	WT + MO2-vps33b	Fig. 3 from Matthews et al., 2005
liver and biliary system morphology, abnormal	WT + MO2-vps33b	Fig. 3 from Matthews et al., 2005
liver and biliary system cytoplasm composition, abnormal	WT + MO2-vps33b	Fig. 5 from Matthews et al., 2005
liver and biliary system epithelial cell structure, abnormal	WT + MO2-vps33b	Fig. 5 from Matthews et al., 2005
vesicle-mediated transport process quality, abnormal	WT + MO2-vps33b	Fig. 6 from Matthews et al., 2005

Phenotype of all Fish created by or utilizing MO2-vps33b

Phenotype	Fish	Conditions	Figures
liver and biliary system cytoplasm composition, abnormal	WT + MO2-vps33b	standard conditions	Fig. 5 from Matthews et al., 2005
vesicle-mediated transport process quality, abnormal	WT + MO2-vps33b	standard conditions	Fig. 6 from Matthews et al., 2005
enterocyte cytoplasm composition, abnormal	WT + MO2-vps33b	standard conditions	Fig. 6 from Matthews et al., 2005
enterocyte Golgi stack dilated, abnormal	WT + MO2-vps33b	standard conditions	Fig. 6 from Matthews et al., 2005
bile ductule decreased amount, abnormal	WT + MO2-vps33b	standard conditions	Fig. 3 from Matthews et al., 2005
intrahepatic bile duct sparse, abnormal	WT + MO2-vps33b	standard conditions	Fig. 3 from Matthews et al., 2005
intrahepatic bile duct decreased amount, abnormal	WT + MO2-vps33b	standard conditions	Fig. 3 from Matthews et al., 2005
liver and biliary system epithelial cell structure, abnormal	WT + MO2-vps33b	standard conditions	Fig. 5 from Matthews et al., 2005
liver and biliary system morphology, abnormal	WT + MO2-vps33b	standard conditions	Fig. 3 from Matthews et al., 2005
intrahepatic bile duct development disrupted, abnormal	WT + MO1-atp6ap2 + MO2-vps33b	standard conditions	Fig. 7 from Eauclaire et al., 2012
intrahepatic bile duct decreased amount, abnormal	WT + MO1-atp6ap2 + MO2-vps33b	standard conditions	Fig. 7 from Eauclaire et al., 2012

Citations