Morpholino

MO2-cxcl12a

ID
ZDB-MRPHLNO-050324-1
Name
MO2-cxcl12a
Previous Names
  • S1a-3-MO (1)
Target
Sequence
5' - ATCACTTTGAGATCCATGTTTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cxcl12a
Expressed Gene Anatomy Figures
ackr3b Fig. 3 with image from Gamba et al., 2010
Fig. 9 with image from Dambly-Chaudière et al., 2007
anos1a Fig. 6 with image from Yanicostas et al., 2008
cxcr4b Fig. 3 with image from Gamba et al., 2010
Phenotype
Phenotype resulting from MO2-cxcl12a
Phenotype Fish Figures
axon guidance disrupted, abnormal zf103Tg + MO2-cxcl12a Fig. 2 from Palevitch et al., 2010
melanophore stripe melanocyte decreased amount, abnormal WT + MO2-cxcl12a Fig. 10 with image from Svetic et al., 2007
neuromast primordium migration delayed, abnormal WT + MO2-cxcl12a Fig. 6 with image from Yanicostas et al., 2008
neuron migration disrupted, abnormal zf103Tg + MO2-cxcl12a Fig. 2 from Palevitch et al., 2010
posterior lateral line neuromast primordium migration disrupted, abnormal WT + MO2-cxcl12a Fig. 9 with image from Dambly-Chaudière et al., 2007
posterior lateral line neuromast primordium migration process quality, abnormal WT + MO2-cxcl12a Fig. 3 with image from Gamba et al., 2010
posterior lateral line primordium physical object quality, abnormal WT + MO2-cxcl12a Fig. 3 with image from Gamba et al., 2010
posterior lateral line primordium actin filament bundle organization process quality, abnormal ui2Tg; zf106Tg + MO2-cxcl12a + MO4-tp53 Fig. 6 with image from Xu et al., 2014
Phenotype of all Fish created by or utilizing MO2-cxcl12a
Phenotype Fish Conditions Figures
posterior lateral line neuromast primordium migration disrupted, abnormal WT + MO2-cxcl12a standard conditions Fig. 9 with image from Dambly-Chaudière et al., 2007
neuromast primordium migration delayed, abnormal WT + MO2-cxcl12a standard conditions Fig. 6 with image from Yanicostas et al., 2008
posterior lateral line primordium physical object quality, abnormal WT + MO2-cxcl12a standard conditions Fig. 3 with image from Gamba et al., 2010
melanophore stripe melanocyte decreased amount, abnormal WT + MO2-cxcl12a standard conditions Fig. 10 with image from Svetic et al., 2007
posterior lateral line neuromast primordium migration process quality, abnormal WT + MO2-cxcl12a standard conditions Fig. 3 with image from Gamba et al., 2010
axon guidance disrupted, abnormal zf103Tg + MO2-cxcl12a standard conditions Fig. 2 from Palevitch et al., 2010
neuron migration disrupted, abnormal zf103Tg + MO2-cxcl12a standard conditions Fig. 2 from Palevitch et al., 2010
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO2-cxcl12a standard conditions Fig. 3 with image from Gamba et al., 2010
posterior lateral line primordium physical object quality, abnormal zf106Tg + MO2-cxcl12a standard conditions Fig. 3 with image from Gamba et al., 2010
posterior lateral line primordium actin filament bundle organization process quality, abnormal ui2Tg; zf106Tg + MO2-cxcl12a + MO4-tp53 standard conditions Fig. 6 with image from Xu et al., 2014
melanocyte mislocalised, abnormal meox1tm26/tm26 + MO2-cxcl12a standard conditions Fig. 10 with image from Svetic et al., 2007
melanocyte position, abnormal meox1tm26/tm26 + MO2-cxcl12a standard conditions Fig. 10 with image from Svetic et al., 2007
neuron migration disrupted, abnormal zf103Tg + MO2-cxcl12a + MO2-cxcr4b standard conditions Fig. 2 from Palevitch et al., 2010
axon guidance disrupted, abnormal zf103Tg + MO2-cxcl12a + MO2-cxcr4b standard conditions Fig. 2 from Palevitch et al., 2010
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO1-esr1 + MO2-cxcl12a standard conditions Fig. 3 with image from Gamba et al., 2010
posterior lateral line primordium physical object quality, abnormal zf106Tg + MO1-esr1 + MO2-cxcl12a standard conditions Fig. 3 with image from Gamba et al., 2010
neuromast primordium migration delayed, abnormal zf106Tg + MO2-anos1a + MO2-cxcl12a standard conditions Fig. 7 with image from Yanicostas et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.