Morpholino

MO1-ptch2

ID
ZDB-MRPHLNO-050308-1
Name
MO1-ptch2
Previous Names
  • MO1-ptc1
  • ptc1 MO1 (1)
Target
Sequence
5' - CATAGTCCAAACGGGAGGCAGAAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptch2
Expressed Gene Anatomy Figures
foxa Fig. EV5 from Pan et al., 2017
Fig. 3 from Zhang et al., 2013
gli1 Fig. 4 from Pan et al., 2017
hhip Fig. EV5 from Pan et al., 2017
Fig. 3 from Zhang et al., 2013
myod1 Fig. 7 with image from Woods et al., 2005
nkx2.2b Fig. 4 from Pan et al., 2017
pax2a Fig. 7 with image from Lee et al., 2008
pax6a Fig. 7 with image from Lee et al., 2008
ptch1 Fig. 7 with image from Lee et al., 2008
ptch2 Fig. 3 from Zhang et al., 2013
Fig. 2 from Wilson et al., 2009
Fig. 7 with image from Lee et al., 2008
Fig. 2 from Beales et al., 2007
Phenotype
Phenotype resulting from MO1-ptch2
Phenotype Fish Figures
brain morphology, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
central nervous system nkx2.2b expression increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
central nervous system gli1 expression increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
central nervous system hhip expression increased amount, abnormal AB + MO1-ptch2 Fig. EV5 from Pan et al., 2017
central nervous system foxa expression increased amount, abnormal AB + MO1-ptch2 Fig. EV5 from Pan et al., 2017
eye curved lateral, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
eye mislocalised medially, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
fast muscle cell increased amount, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
fast muscle cell mislocalised, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
lens displaced, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
muscle morphology, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
muscle pioneer increased amount, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
optic fissure closure incomplete, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
retina protruding, abnormal AB + MO1-ptch2 Fig. 7 with image from Lee et al., 2008
slow muscle cell increased amount, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
slow muscle cell mislocalised, abnormal WT + MO1-ptch2 Fig. 2 from Wolff et al., 2003
smoothened signaling pathway disrupted, abnormal AB + MO1-ptch2 Fig. 2 from Wilson et al., 2009
somite hhip expression increased amount, abnormal AB + MO1-ptch2 Fig. EV5 from Pan et al., 2017
somite foxa expression increased amount, abnormal AB + MO1-ptch2 Fig. EV5 from Pan et al., 2017
somite nkx2.2b expression increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
somite gli1 expression increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
somite U-shaped, abnormal AB + MO1-ptch2 Fig. S10 from Wilson et al., 2009
somite muscle pioneer increased amount, abnormal AB + MO1-ptch2 Fig. 4 from Pan et al., 2017
Fig. S10 from Wilson et al., 2009
Phenotype of all Fish created by or utilizing MO1-ptch2
Phenotype Fish Conditions Figures
eye mislocalised medially, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
somite muscle pioneer increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
Fig. S10 from Wilson et al., 2009
somite foxa expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
lens displaced, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
brain morphology, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
optic fissure closure incomplete, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
central nervous system foxa expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
muscle morphology, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
smoothened signaling pathway disrupted, abnormal AB + MO1-ptch2 standard conditions Fig. 2 from Wilson et al., 2009
somite U-shaped, abnormal AB + MO1-ptch2 standard conditions Fig. S10 from Wilson et al., 2009
eye curved lateral, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
somite nkx2.2b expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
retina protruding, abnormal AB + MO1-ptch2 standard conditions Fig. 7 with image from Lee et al., 2008
somite hhip expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
central nervous system gli1 expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
central nervous system hhip expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
central nervous system nkx2.2b expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
somite gli1 expression increased amount, abnormal AB + MO1-ptch2 standard conditions Fig. 4 from Pan et al., 2017
muscle pioneer mislocalised, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell increased amount, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell mislocalised, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer increased amount, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
fast muscle cell mislocalised, abnormal WT + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3,  Fig. 4 with image from Ochi et al., 2006
whole organism ptch2 expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 5 with image from Ochi et al., 2006
fast muscle cell decreased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3 from Ochi et al., 2006
slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 3,  Fig. 4 with image from Ochi et al., 2006
whole organism hhip expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 5 with image from Ochi et al., 2006
whole organism foxa expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
somite U-shaped, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 4 with image from Ochi et al., 2006
whole organism gli1 expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
whole organism nkx2.2b expression increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 standard conditions Fig. EV5 from Pan et al., 2017
fast muscle cell mislocalised, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer mislocalised, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
adaxial cell dispersed, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer increased amount, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
fast muscle cell increased amount, abnormal WT + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell absent, abnormal smob641/b641 + MO1-ptch1 + MO1-ptch2 (AB) standard conditions Fig. 2 from Wolff et al., 2003
slow muscle cell increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 + MO2-hhip + MO3-hhip standard conditions Fig. 3 from Ochi et al., 2006
muscle pioneer increased amount, abnormal AB + MO1-ptch1 + MO1-ptch2 + MO2-hhip + MO3-hhip standard conditions Fig. 3 from Ochi et al., 2006
fast muscle cell decreased amount, abnormal ndr2tf219/tf219; Df(Chr07)t4/t4 + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
muscle pioneer absent, abnormal ndr2tf219/tf219; Df(Chr07)t4/t4 + MO1-ptch1 + MO1-ptch2 standard conditions Fig. 2 from Wolff et al., 2003
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.