Morpholino
MO1-ptch2
- ID
- ZDB-MRPHLNO-050308-1
- Name
- MO1-ptch2
- Previous Names
-
- MO1-ptc1
- ptc1 MO1 (1)
- Target
- Sequence
-
5' - CATAGTCCAAACGGGAGGCAGAAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptch2
Expressed Gene | Anatomy | Figures |
---|---|---|
foxa |
Fig. EV5
from Pan et al., 2017 Fig. 3 from Zhang et al., 2013 |
|
gli1 |
Fig. 4
from Pan et al., 2017 |
|
hhip |
Fig. EV5
from Pan et al., 2017 Fig. 3 from Zhang et al., 2013 |
|
myod1 |
Fig. 7 ![]() |
|
nkx2.2b |
Fig. 4
from Pan et al., 2017 |
|
pax2a |
Fig. 7 ![]() |
|
pax6a |
Fig. 7 ![]() |
|
ptch1 |
Fig. 7 ![]() |
|
ptch2 |
Fig. 3
from Zhang et al., 2013 Fig. 2 from Wilson et al., 2009 Fig. 7 ![]() Fig. 2 from Beales et al., 2007 |
Phenotype
Phenotype resulting from MO1-ptch2
No data available
Phenotype of all Fish created by or utilizing MO1-ptch2
No data available
Citations