Morpholino

MO2-dlx3b

ID
ZDB-MRPHLNO-050208-13
Name
MO2-dlx3b
Previous Names
  • dlx3-1 MO (1)
Target
Sequence
5' - ATATGTCGGTCCACTCATCCTTAAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a dlx3b translation blocker. Mackereth et al. (2005) shows an extra T near the 3'-end due to a misprint. The correct sequence is displayed here.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dlx3b
Phenotype
Phenotype resulting from MO2-dlx3b
Phenotype of all Fish created by or utilizing MO2-dlx3b
Phenotype Fish Conditions Figures
otic vesicle decreased size, abnormal WT + MO2-dlx3b standard conditions Fig. 2 with image from Solomon et al., 2002
otic vesicle development process quality, abnormal WT + MO2-dlx3b standard conditions Fig. 4 with image from Solomon et al., 2002
olfactory placode development process quality, abnormal WT + MO2-dlx3b standard conditions Fig. 4 with image from Solomon et al., 2002
otolith decreased amount, abnormal WT + MO2-dlx3b standard conditions Fig. 2 with image from Solomon et al., 2002
otolith absent, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
olfactory placode formation arrested, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 5 with image from Solomon et al., 2002
otic placode pax2a expression absent, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 6 with image from Sun et al., 2007
otic vesicle development process quality, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
otic vesicle decreased size, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
olfactory placode development process quality, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
otic vesicle development process quality, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
olfactory placode development process quality, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
otolith absent, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
otic vesicle decreased size, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
olfactory placode formation arrested, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 5 with image from Solomon et al., 2002
otic vesicle decreased size, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle lacks all parts of type hair cell, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle lacks all parts of type otolith, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
Citations