Morpholino

MO1-bmp2b

ID

ZDB-MRPHLNO-041217-6

Name

MO1-bmp2b

Previous Names

bmp2b MO (1)
bmp2bmorph (1)

Target

bmp2b (1)

Sequence

5' - CGCGGACCACGGCGACCATGATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-bmp2b

Expressed Gene	Anatomy	Figures
admp	shield	Fig. 4 from Yan et al., 2019
chrd	shield	Fig. 6 from Yan et al., 2019
egr2b	presumptive rhombomere 3 presumptive rhombomere 5	Fig. 5 from Rentzsch et al., 2006 Fig. 1 from Lele et al., 2001
eve1	margin anterior region mesoderm (not) whole organism	Fig. 6 from Yan et al., 2019 Fig. 2 from von der Hardt et al., 2007 Fig. 3 from Rentzsch et al., 2006
gata1a	whole organism	Fig. S2 from von der Hardt et al., 2007
pcdh8	mesoderm	Fig. 2 from von der Hardt et al., 2007
pnhd	margin anterior region	Fig. 4 from Yan et al., 2019
spaw	lateral plate mesoderm	Fig. 7 from Chocron et al., 2007
szl	whole organism	Fig. S2 from von der Hardt et al., 2007
tbx6	mesoderm	Fig. 2 from von der Hardt et al., 2007

Phenotype

Phenotype resulting from MO1-bmp2b

Phenotype	Fish	Figures
dorsal convergence disrupted, abnormal	WT + MO1-bmp2b	Fig. 1 , Fig. 4 from von der Hardt et al., 2007
lateral mesoderm mislocalised, abnormal	WT + MO1-bmp2b	Fig. 1 from von der Hardt et al., 2007
margin anterior region pnhd expression decreased distribution, abnormal	TU + MO1-bmp2b	Fig. 4 from Yan et al., 2019
rhombomere 3 left side fused with rhombomere 3 right side, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
rhombomere 5 left side fused with rhombomere 5 right side, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
shield admp expression increased distribution, abnormal	TU + MO1-bmp2b	Fig. 4 from Yan et al., 2019
somite circular, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
somite fused with somite, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
whole organism wholly dorsalized, abnormal	t32231Tg + MO1-bmp2b	Fig. S4 from Miyares et al., 2013 Fig. 3 from Chen et al., 2012 Fig. 1 from Lele et al., 2001
yolk broken, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001
yolk protruding, abnormal	WT + MO1-bmp2b	Fig. 1 from Lele et al., 2001

Phenotype of all Fish created by or utilizing MO1-bmp2b

Phenotype	Fish	Conditions	Figures
margin anterior region pnhd expression decreased distribution, abnormal	TU + MO1-bmp2b	standard conditions	Fig. 4 from Yan et al., 2019
shield admp expression increased distribution, abnormal	TU + MO1-bmp2b	standard conditions	Fig. 4 from Yan et al., 2019
rhombomere 3 left side fused with rhombomere 3 right side, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
whole organism wholly dorsalized, abnormal	WT + MO1-bmp2b	standard conditions	Fig. S4 from Miyares et al., 2013 Fig. 1 from Lele et al., 2001
lateral mesoderm mislocalised, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from von der Hardt et al., 2007
somite fused with somite, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
somite circular, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
rhombomere 5 left side fused with rhombomere 5 right side, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
yolk broken, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
yolk protruding, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 from Lele et al., 2001
dorsal convergence disrupted, abnormal	WT + MO1-bmp2b	standard conditions	Fig. 1 , Fig. 4 from von der Hardt et al., 2007
whole organism wholly dorsalized, abnormal	t32231Tg + MO1-bmp2b	standard conditions	Fig. 3 from Chen et al., 2012
whole organism posterior region malformed, exacerbated	admp^ioz10/ioz10; pnhd^ioz11/ioz11 + MO1-bmp2b (TU)	standard conditions	Fig. 6 from Yan et al., 2019
margin anterior region eve1 expression decreased distribution, abnormal	admp^ioz10/ioz10; pnhd^ioz11/ioz11 + MO1-bmp2b (TU)	standard conditions	Fig. 6 from Yan et al., 2019
shield chrd expression increased distribution, abnormal	admp^ioz10/ioz10; pnhd^ioz11/ioz11 + MO1-bmp2b (TU)	standard conditions	Fig. 6 from Yan et al., 2019

Citations