CRISPR

CRISPR1-sgcd

ID
ZDB-CRISPR-240806-1
Name
CRISPR1-sgcd
Previous Names
None
Target
Sequence
5' - GAGTGGGGATCTACGGCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added. The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ia401 sgcd
Expression
Gene expression in Wild Types + CRISPR1-sgcd
No data available
Phenotype
Phenotype resulting from CRISPR1-sgcd
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sgcd
Phenotype Fish Conditions Figures
skeletal muscle cell morphology, abnormal sgcdia401/ia401 standard conditions Figure 4 with image from Dalla Barba et al., 2023
skeletal muscle cell fragmented, abnormal sgcdia401/ia401 standard conditions Figure 5 with image from Dalla Barba et al., 2023
whole organism Ab1-sgcd labeling absent, abnormal sgcdia401/ia401 standard conditions Figure 1 with image from Dalla Barba et al., 2023
skeletal muscle cell degenerate, abnormal sgcdia401/ia401 standard conditions Figure 3 with image from Dalla Barba et al., 2023
leukocyte Ab8-lcp1 labeling increased distribution, abnormal sgcdia401/ia401 standard conditions Figure 4 with image from Dalla Barba et al., 2023
swimming behavior decreased process quality, abnormal sgcdia401/ia401 control Figure 6 with image from Dalla Barba et al., 2023
skeletal muscle inflamed, abnormal sgcdia401/ia401 standard conditions Figure 4 with image from Dalla Barba et al., 2023
skeletal muscle cell sarcomere organization quality, abnormal sgcdia401/ia401 standard conditions Figure 3 with imageFigure 5 with image from Dalla Barba et al., 2023
skeletal muscle cell myoseptum detached from skeletal muscle cell myoseptum, abnormal sgcdia401/ia401 standard conditions Figure 3 with image from Dalla Barba et al., 2023
skeletal muscle cell mitochondrion degenerate, abnormal sgcdia401/ia401 standard conditions Figure 3 with image from Dalla Barba et al., 2023
skeletal muscle adipose tissue infiltrative, abnormal sgcdia401/ia401 standard conditions Figure 4 with image from Dalla Barba et al., 2023
skeletal muscle cell sarcoplasmic reticulum dilated, abnormal sgcdia401/ia401 standard conditions Figure 3 with imageFigure 5 with image from Dalla Barba et al., 2023
startle response decreased process quality, abnormal sgcdia401/ia401 lighting conditions Figure 2 with image from Dalla Barba et al., 2023
skeletal muscle cell disorganized, abnormal sgcdia401/ia401 chemical treatment by environment: methyl cellulose Figure 7 with image from Dalla Barba et al., 2023
muscle cell damaged, abnormal sgcdia401/ia401 standard conditions Figure 3 with imageFigure 5 with image from Dalla Barba et al., 2023
skeletal muscle cell disorganized, abnormal sgcdia401/ia401 standard conditions Figure 4 with imageFigure 5 with image from Dalla Barba et al., 2023
myotome undulate, abnormal sgcdia401/ia401 chemical treatment by environment: methyl cellulose Figure 7 with image from Dalla Barba et al., 2023
skeletal muscle cell sarcomere organization quality, abnormal sgcdia401/ia401 chemical treatment by environment: methyl cellulose Figure 7 with image from Dalla Barba et al., 2023
skeletal muscle cell myoseptum detached from skeletal muscle cell myoseptum, abnormal sgcdia401/ia401 chemical treatment by environment: methyl cellulose Figure 7 with image from Dalla Barba et al., 2023
Citations