CRISPR

CRISPR1-sp5a

ID
ZDB-CRISPR-240325-6
Name
CRISPR1-sp5a
Previous Names
None
Target
Sequence
5' - AGGCATGGCTGGAGGGATGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
x69 sp5a
Expression
Gene expression in Wild Types + CRISPR1-sp5a
No data available
Phenotype
Phenotype resulting from CRISPR1-sp5a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sp5a
Phenotype Fish Conditions Figures
otic vesicle sp5l expression amount, ameliorated sp5ax69/x69 + MO2-sp5l standard conditions Fig. 10 with image from Tan et al., 2022
otic vesicle sp5l expression spatial pattern, ameliorated sp5ax69/x69 + MO2-sp5l standard conditions Fig. 10 with image from Tan et al., 2022
otic vesicle pax5 expression amount, ameliorated sp5ax69/x69 + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased distribution, abnormal sp5ax69/x69 + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle pax5 expression spatial pattern, ameliorated sp5ax69/x69 + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle neurog1 expression decreased amount, abnormal sp5ax69/x69 + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased amount, abnormal sp5ax69/x69 + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
statoacoustic (VIII) ganglion neuron ab2-isl labeling decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 11 with image from Tan et al., 2022
otic vesicle gsc expression decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
statoacoustic (VIII) ganglion neuron ab2-isl labeling decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic placode atoh1a expression decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle medial region sp5a expression decreased distribution, abnormal sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
otic vesicle neurog1 expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
otic placode atoh1a expression decreased distribution, abnormal sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle anterior region atoh1a expression increased distribution, abnormal sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
otic vesicle medial region sp5a expression decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
otic vesicle medial region sp5l expression decreased distribution, abnormal sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
otic vesicle medial region pax2a expression decreased distribution, abnormal sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
otic vesicle medial region sp5l expression decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
otic vesicle medial region pax2a expression decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
otic vesicle neurog1 expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 8 with image from Tan et al., 2022
otic vesicle sp5l expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased distribution, abnormal sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle pax5 expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle sp5l expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle pax5 expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle neurog1 expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle neurog1 expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle hair cell GFP expression increased amount, abnormal sp5ax69/x69; sp5lx70/x70; s356tTg/s356tTg chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle pou3f3b expression decreased distribution, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle sp5a expression increased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle pax2a expression increased distribution, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
statoacoustic (VIII) ganglion neuron ab2-isl labeling decreased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle atoh1a expression increased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle sp5l expression increased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle sp5l expression increased distribution, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic placode atoh1a expression decreased distribution, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle pax2a expression increased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle sp5a expression increased distribution, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle gsc expression decreased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle pou3f3b expression decreased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle pax5 expression decreased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 11 with image from Tan et al., 2022
otic vesicle pou3f3b expression decreased distribution, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 11 with image from Tan et al., 2022
otic vesicle pax5 expression decreased distribution, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 11 with image from Tan et al., 2022
otic vesicle pax5 expression decreased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle pou3f3b expression decreased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 11 with image from Tan et al., 2022
statoacoustic (VIII) ganglion neuron ab2-isl labeling decreased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 11 with image from Tan et al., 2022
otic placode atoh1a expression decreased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle atoh1a expression increased distribution, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle pax5 expression decreased distribution, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70 chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle hair cell GFP expression increased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70; s356tTg/s356tTg chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 11 with image from Tan et al., 2022
otic vesicle hair cell GFP expression increased amount, abnormal pax2atu29a/tu29a; sp5ax69/x69; sp5lx70/x70; s356tTg/s356tTg standard conditions Fig. 11 with image from Tan et al., 2022
Citations