CRISPR

CRISPR6-jag2b

ID

ZDB-CRISPR-230421-4

Name

CRISPR6-jag2b

Previous Names

None

Target

jag2b (1)

Sequence

5' - GGCTTCTGCCAGGGACCCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ion28h	jag2b

Expression

Gene expression in Wild Types + CRISPR6-jag2b

No data available

Phenotype

Phenotype resulting from CRISPR6-jag2b

No data available

Phenotype of all Fish created by or utilizing CRISPR6-jag2b

Phenotype	Fish	Conditions	Figures
Muller cell glial cell development decreased rate, abnormal	jag2b^{ion28h/ion28h}	standard conditions	Fig. 2 from Jin et al., 2022
Muller cell decreased amount, abnormal	jag2b^{ion28h/ion28h}	standard conditions	Fig. 2 from Jin et al., 2022
hematopoietic stem cell differentiation decreased process quality, abnormal	AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 2 from Wada et al., 2022
dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal	AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 2 from Wada et al., 2022
dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal	AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 2 from Wada et al., 2022
somite dld expression decreased amount, abnormal	AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 4 from Wada et al., 2022
somite efna1b expression decreased amount, abnormal	AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 5 from Wada et al., 2022
somite wnt16 expression decreased amount, abnormal	AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 4 from Wada et al., 2022
somite dlc expression decreased amount, abnormal	AB + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 4 from Wada et al., 2022
ventral wall of dorsal aorta hematopoietic stem cell differentiation decreased process quality, abnormal	hzm7Et + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 3 from Wada et al., 2022
dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal	hzm7Et + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 3 from Wada et al., 2022
dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal	hzm7Et + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 3 from Wada et al., 2022
somite Notch signaling pathway decreased process quality, abnormal	um14Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 3 from Wada et al., 2022
somite EGFP expression decreased amount, abnormal	um14Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 3 from Wada et al., 2022
retinal inner plexiform layer CFP expression decreased amount, abnormal	jag2b^{ion28h/ion28h}; ion21hTg/ion21hTg	standard conditions	Fig. 4 from Jin et al., 2022
Muller cell ab1-glul labeling decreased amount, abnormal	jag2b^{ion28h/ion28h}; ion21hTg/ion21hTg	standard conditions	Fig. 4 from Jin et al., 2022
Muller cell transformed to retinal bipolar neuron, abnormal	jag2b^{ion28h/ion28h}; ion23hTg/ion23hTg; nns5Tg/nns5Tg; s1999tTg/s1999tTg	ultraviolet light	Fig. 5 from Jin et al., 2022
retinal bipolar neuron Kaede expression increased amount, abnormal	jag2b^{ion28h/ion28h}; ion23hTg/ion23hTg; nns5Tg/nns5Tg; s1999tTg/s1999tTg	ultraviolet light	Fig. 5 from Jin et al., 2022
retinal bipolar neuron EGFP expression increased amount, abnormal	jag2b^{ion28h/ion28h}; ion23hTg/ion23hTg; nns5Tg/nns5Tg; s1999tTg/s1999tTg	ultraviolet light	Fig. 5 from Jin et al., 2022
Muller cell ab1-glul labeling decreased amount, abnormal	jag2b^{ion28h/ion28h}; ion23hTg/ion23hTg; nns5Tg/nns5Tg; s1999tTg/s1999tTg	ultraviolet light	Fig. 5 from Jin et al., 2022
ventral wall of dorsal aorta hematopoietic stem cell differentiation decreased process quality, abnormal	ncv7Tg; nkgSAIzGFFM1770AGt; nkuasgfp1aTg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 2 from Wada et al., 2022
ventral wall of dorsal aorta has fewer parts of type hematopoietic stem cell, abnormal	ncv7Tg; nkgSAIzGFFM1770AGt; nkuasgfp1aTg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 2 from Wada et al., 2022
dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated	hzm7Et; kca3Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 3 from Wada et al., 2022
ventral wall of dorsal aorta hematopoietic stem cell differentiation process quality, ameliorated	hzm7Et; kca3Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 3 from Wada et al., 2022
dorsal aorta has number of hematopoietic stem cell, ameliorated	hzm7Et; kca3Tg + CRISPR3-jag2b + CRISPR4-jag2b + CRISPR5-jag2b + CRISPR6-jag2b	standard conditions	Fig. 3 from Wada et al., 2022
Muller cell ab1-glul labeling amount, ameliorated	jag2b^{ion28h/ion28h}; ion20hTg/ion20hTg; ion21hTg/ion21hTg	standard conditions	Fig. 4 from Jin et al., 2022
retinal inner plexiform layer CFP expression amount, ameliorated	jag2b^{ion28h/ion28h}; ion20hTg/ion20hTg; ion21hTg/ion21hTg	standard conditions	Fig. 4 from Jin et al., 2022

Citations