CRISPR

CRISPR3-lepb

ID
ZDB-CRISPR-220331-13
Name
CRISPR3-lepb
Previous Names
None
Target
Sequence
5' - CTACCCAATCCCGAGACCCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ibl54 lepb
ibl55 lepb
Expression
Gene expression in Wild Types + CRISPR3-lepb
No data available
Phenotype
Phenotype resulting from CRISPR3-lepb
No data available
Phenotype of all Fish created by or utilizing CRISPR3-lepb
Phenotype Fish Conditions Figures
whole organism aspartate decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Fig. 2 with image from Ding et al., 2022
whole organism citrulline decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Fig. 2 with image from Ding et al., 2022
whole organism phenylalanine decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Fig. 2 with image from Ding et al., 2022
whole organism threonine decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Table 1 from Ding et al., 2022
defense response to bacterium decreased process quality, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Fig. 1 from Ding et al., 2022
whole organism tyrosine decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Fig. 2 with image from Ding et al., 2022
whole organism acetate decreased amount, abnormal lepbibl54/ibl54 control Fig. 3 with image from Ding et al., 2022
whole organism glycine decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Table 1 from Ding et al., 2022
whole organism putrescine decreased amount, abnormal lepbibl54/ibl54 control Fig. 3 with image from Ding et al., 2022
whole organism alanine decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Fig. 2 with image from Ding et al., 2022
whole organism cysteine decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Table 1 from Ding et al., 2022
whole organism lysine decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Fig. 2 with image from Ding et al., 2022
whole organism glutamine decreased amount, abnormal lepbibl54/ibl54 control Fig. 3 with image from Ding et al., 2022
whole organism mannose increased amount, abnormal lepbibl54/ibl54 control Fig. 3 with image from Ding et al., 2022
whole organism histidine decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Table 1 from Ding et al., 2022
whole organism leucine decreased amount, abnormal lepbibl54/ibl54 bacterial treatment by injection: Mycobacterium marinum M Table 1 from Ding et al., 2022
whole organism glycine decreased amount, abnormal lepbibl54/ibl54 control Fig. 3 with image from Ding et al., 2022
whole organism increased length, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 1 from He et al., 2021
whole organism aspartate increased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image from Ding et al., 2021
whole organism citrulline decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
male organism renal glomerulus hypertrophic, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 3 from He et al., 2021
whole organism glutamine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
male organism pronephric capsular space increased area, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 3 from He et al., 2021
whole organism docosahexaenoic acid increased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 6 with image from Ding et al., 2021
whole organism alanine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
whole organism cysteine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image from Ding et al., 2021
male organism renal glomerular capsule increased area, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 3 from He et al., 2021
whole organism asparagine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image from Ding et al., 2021
whole organism methionine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
male organism renal glomerulus increased area, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 3 from He et al., 2021
whole organism acetate decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image from Ding et al., 2021
lipid metabolic process process quality, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 6 with image from Ding et al., 2021
whole organism ethanolamine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
whole organism increased weight, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 1 from He et al., 2021
whole organism glucose increased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image from Ding et al., 2021
blood glucose increased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 1 from He et al., 2021
renal glomerulus glomerular basement membrane accumulation glomerular basement membrane extracellular matrix, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 from He et al., 2021
whole organism histidine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
whole organism lactate decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image from Ding et al., 2021
whole organism phosphatidylcholine increased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 6 with image from Ding et al., 2021
whole organism myo-inositol decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image from Ding et al., 2021
whole organism leucine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
whole organism visceral fat increased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 2 from He et al., 2021
whole organism glycine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
whole organism isoleucine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
whole organism serine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
male organism glomerular basement membrane increased thickness, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 from He et al., 2021
whole organism putrescine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
whole organism phenylalanine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
whole organism threonine decreased amount, abnormal lepbibl54/ibl54 (AB/TL) standard conditions Fig. 4 with image,  Fig. 5 with image from Ding et al., 2021
whole organism increased length, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 1 from He et al., 2021
male organism renal glomerulus hypertrophic, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 3 from He et al., 2021
male organism renal glomerular capsule increased area, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 3 from He et al., 2021
male organism pronephric capsular space increased area, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 3 from He et al., 2021
whole organism increased weight, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 1 from He et al., 2021
male organism renal glomerulus increased area, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 3 from He et al., 2021
blood glucose increased amount, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 1 from He et al., 2021
renal glomerulus glomerular basement membrane accumulation glomerular basement membrane extracellular matrix, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 4 from He et al., 2021
whole organism visceral fat increased amount, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 2 from He et al., 2021
male organism glomerular basement membrane increased thickness, abnormal lepbibl55/ibl55 (AB/TL) standard conditions Fig. 4 from He et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.