CRISPR

CRISPR1-akr1a1b

ID
ZDB-CRISPR-210907-1
Name
CRISPR1-akr1a1b
Previous Names
None
Target
Sequence
5' - GGTCCAAGTACTCCAGCTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site is "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uh8 akr1a1b
uh9 akr1a1b
Expression
Gene expression in Wild Types + CRISPR1-akr1a1b
No data available
Phenotype
Phenotype resulting from CRISPR1-akr1a1b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-akr1a1b
Phenotype Fish Conditions Figures
renal glomerulus length, ameliorated akr1a1buh8/uh8; li1Tg chemical treatment: N(gamma)-nitro-L-arginine methyl ester Fig. 7 with image from Li et al., 2020
whole organism aldo-keto reductase (NADPH) activity decreased process quality, abnormal akr1a1buh8/uh8; li1Tg standard conditions Fig. 2 with image from Li et al., 2020
renal glomerulus size, ameliorated akr1a1buh8/uh8; li1Tg chemical treatment: N(gamma)-nitro-L-arginine methyl ester Fig. 7 with image from Li et al., 2020
renal glomerulus increased size, abnormal akr1a1buh8/uh8; li1Tg control Fig. 3 with imageFig. 7 with image from Li et al., 2020
renal glomerulus glomerular filtration decreased rate, abnormal akr1a1buh8/uh8; li1Tg chemical treatment by injection: dextran Fig. 3 with image from Li et al., 2020
renal glomerulus increased length, abnormal akr1a1buh8/uh8; li1Tg control Fig. 3 with imageFig. 7 with image from Li et al., 2020
whole organism alanine increased amount, abnormal akr1a1buh8/uh8; li1Tg standard conditions Fig. 5 with image from Li et al., 2020
whole organism glutamate(1-) increased amount, abnormal akr1a1buh8/uh8; li1Tg standard conditions Fig. 5 with image from Li et al., 2020
whole organism methylglyoxal increased amount, abnormal akr1a1buh9/+; akr1a1buh8/+; li1Tg; y1Tg standard conditions Fig. 2 with image from Li et al., 2020
liver pck1 expression decreased amount, abnormal akr1a1buh9/+; akr1a1buh8/+; li1Tg; y1Tg fasting Fig. 6 with image from Li et al., 2020
kidney glutamate(1-) increased amount, abnormal akr1a1buh9/+; akr1a1buh8/+; li1Tg; y1Tg fasting Fig. 5 with image from Li et al., 2020
blood glucose decreased amount, abnormal akr1a1buh9/+; akr1a1buh8/+; li1Tg; y1Tg fasting Fig. 6 with image from Li et al., 2020
kidney pck1 expression decreased amount, abnormal akr1a1buh9/+; akr1a1buh8/+; li1Tg; y1Tg fasting Fig. 6 with image from Li et al., 2020
whole organism nitrotyrosine increased amount, abnormal akr1a1buh9/uh9; y1Tg standard conditions Fig. 7 with image from Li et al., 2020
whole organism pck1 expression decreased amount, abnormal akr1a1buh9/uh9; y1Tg control Fig. 7 with image from Li et al., 2020
whole organism pck1 expression amount, ameliorated akr1a1buh9/uh9; y1Tg chemical treatment: N(gamma)-nitro-L-arginine methyl ester Fig. 7 with image from Li et al., 2020
kidney protein nitrosylation increased process quality, abnormal akr1a1buh9/uh9; y1Tg standard conditions Fig. 7 with image from Li et al., 2020
pronephric proximal convoluted tubule lysosome increased amount, abnormal akr1a1buh9/uh9; y1Tg standard conditions Fig. 4 with image from Li et al., 2020
Citations