CRISPR

CRISPR1-neu1

ID
ZDB-CRISPR-210416-5
Name
CRISPR1-neu1
Previous Names
None
Target
Sequence
5' - GACAAATTGGAATTTTACTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ggc10d neu1
zf3377 neu1
Expression
Gene expression in Wild Types + CRISPR1-neu1
No data available
Phenotype
Phenotype resulting from CRISPR1-neu1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-neu1
Phenotype Fish Conditions Figures
brain glycosphingolipid increased amount, abnormal neu1zf3377/zf3377 standard conditions Figure 7 with image from Ikeda et al., 2021
brain lamp1a expression increased amount, abnormal neu1zf3377/zf3377 standard conditions Figure 8 with image from Ikeda et al., 2021
brain oxt expression decreased amount, abnormal neu1zf3377/zf3377 standard conditions Figure 6 with image from Ikeda et al., 2021
brain pmch expression decreased amount, abnormal neu1zf3377/zf3377 standard conditions Figure 6 with image from Ikeda et al., 2021
whole organism Ab2-lamp1 labeling increased amount, abnormal neu1zf3377/zf3377 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 3 from Sahashi et al., 2022
aggressive behavior decreased occurrence, abnormal neu1zf3377/zf3377 standard conditions Figure 2 with image from Ikeda et al., 2021
brain tfeb expression increased amount, abnormal neu1zf3377/zf3377 standard conditions Figure 8 with image from Ikeda et al., 2021
brain nr3c2 expression decreased amount, abnormal neu1zf3377/zf3377 standard conditions Figure 6 with image from Ikeda et al., 2021
pronephros lysosome increased amount, abnormal neu1zf3377/zf3377 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 3 from Sahashi et al., 2022
brain Ab2-lamp1 labeling increased amount, abnormal neu1zf3377/zf3377 standard conditions Figure 8 with image from Ikeda et al., 2021
intestine lysosome increased amount, abnormal neu1zf3377/zf3377 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 3 from Sahashi et al., 2022
social behavior disrupted, abnormal neu1zf3377/zf3377 standard conditions Figure 1 with image from Ikeda et al., 2021
whole organism ab1-map1lc3b labeling increased amount, abnormal neu1zf3377/zf3377 standard conditions Fig. 5 from Sahashi et al., 2022
macrophage lysosome decreased functionality, abnormal neu1zf3377/zf3377 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 3 from Sahashi et al., 2022
whole organism gpx1a expression increased amount, abnormal neu1zf3377/zf3377 standard conditions Fig. 5 from Sahashi et al., 2022
whole organism sod1 expression increased amount, abnormal neu1zf3377/zf3377 standard conditions Fig. 5 from Sahashi et al., 2022
whole organism ab2-sqstm1 labeling decreased amount, abnormal neu1zf3377/zf3377 standard conditions Fig. 5 from Sahashi et al., 2022
whole organism nos2b expression increased amount, abnormal neu1zf3377/zf3377 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 2 from Sahashi et al., 2022
brain galns expression increased amount, abnormal neu1zf3377/zf3377 standard conditions Figure 8 with image from Ikeda et al., 2021
brain ctsa expression increased amount, abnormal neu1zf3377/zf3377 standard conditions Figure 8 with image from Ikeda et al., 2021
whole organism mpeg1.1 expression increased amount, abnormal neu1zf3377/zf3377 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 2 from Sahashi et al., 2022
whole organism increased distance whole organism, abnormal neu1zf3377/zf3377 standard conditions Figure 1 with image from Ikeda et al., 2021
whole organism decreased life span, abnormal neu1zf3377/zf3377 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 1 from Sahashi et al., 2022
whole organism aif1l expression increased amount, abnormal neu1zf3377/zf3377 bacterial treatment by exposure to environment: Edwardsiella piscicida Fig. 2 from Sahashi et al., 2022
liver alpha-sialidase activity decreased process quality, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 3 from Okada et al., 2020
muscle lamp1a expression increased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 6 from Okada et al., 2020
peripheral olfactory organ lysosome increased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 4 from Okada et al., 2020
muscle mmp9 expression decreased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 6 from Okada et al., 2020
muscle tfeb expression increased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 6 from Okada et al., 2020
whole organism alpha-sialidase activity decreased process quality, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 3 from Okada et al., 2020
brain lysosome increased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 4 from Okada et al., 2020
pericardial cavity edematous, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 5 from Okada et al., 2020
bone tissue mmp9 expression decreased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 7 from Okada et al., 2020
brain sirt1 expression increased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 5 from Okada et al., 2020
whole organism myog expression increased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 6 from Okada et al., 2020
bone tissue runx2b expression decreased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 7 from Okada et al., 2020
whole organism myog expression decreased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 6 from Okada et al., 2020
whole organism decreased life span, abnormal neu1zf3377/zf3377 (RW) standard conditions text only from Okada et al., 2020
muscle connective tissue cell distended, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 5 from Okada et al., 2020
vertebral column curved, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 5 from Okada et al., 2020
whole organism dead, abnormal neu1zf3377/zf3377 (RW) standard conditions text only from Okada et al., 2020
whole organism myod1 expression decreased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 6 from Okada et al., 2020
muscle ctsa expression increased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 6 from Okada et al., 2020
bone tissue runx2a expression decreased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 7 from Okada et al., 2020
whole organism myod1 expression increased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 6 from Okada et al., 2020
whole organism neu3.2 expression increased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 3 from Okada et al., 2020
whole organism exo-alpha-sialidase activity process quality, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 4 from Okada et al., 2020
whole organism locomotion decreased process quality, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 5 from Okada et al., 2020
muscle cell atrophied, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 5 from Okada et al., 2020
whole organism neu3.4 expression decreased amount, abnormal neu1zf3377/zf3377 (RW) standard conditions Fig. 3 from Okada et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.