CRISPR

CRISPR1-dre-mir-183

ID
ZDB-CRISPR-191202-1
Name
CRISPR1-dre-mir-183
Previous Names
  • CRISPR1-mir183
Target
Sequence
5' - GGAGACTCCTGTTCTGTGTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two 'G's were added to facilitate T7-dependent transcription.
Genome Resources
None
Target Location
View all 4 target locations
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78 dre-mir-96, dre-mir-182, dre-mir-183
Df(Chr4:dre-mir-183,dre-mir-182)lri81 dre-mir-182, dre-mir-183
Df(Chr4:dre-mir-96,dre-mir-183)lri69 dre-mir-96, dre-mir-183
lri70 dre-mir-183
Expression
Gene expression in Wild Types + CRISPR1-dre-mir-183
No data available
Phenotype
Phenotype resulting from CRISPR1-dre-mir-183
No data available
Phenotype of all Fish created by or utilizing CRISPR1-dre-mir-183
Phenotype Fish Conditions Figures
neuromast has fewer parts of type neuromast hair cell, abnormal Df(Chr4:dre-mir-183,dre-mir-182)lri81/lri81 chemical treatment by environment: gentamycin Fig. 7 with image from Fogerty et al., 2019
retina dre-mir-183 expression decreased amount, abnormal Df(Chr4:dre-mir-183,dre-mir-182)lri81/lri81 standard conditions Fig. 3 with image from Fogerty et al., 2019
retina dre-mir-182 expression decreased amount, abnormal Df(Chr4:dre-mir-183,dre-mir-182)lri81/lri81 standard conditions Fig. 3 with image from Fogerty et al., 2019
neuromast has fewer parts of type neuromast hair cell, abnormal dre-mir-183lri70/lri70 chemical treatment by environment: gentamycin Fig. 7 with image from Fogerty et al., 2019
retina dre-mir-183 expression decreased amount, abnormal dre-mir-183lri70/lri70 standard conditions Fig. 3 with image from Fogerty et al., 2019
neuromast hair cell stereocilium maintenance decreased process quality, abnormal Df(Chr4:dre-mir-96,dre-mir-183)lri69/lri69 standard conditions Fig. 7 with image from Fogerty et al., 2019
retina dre-mir-96 expression absent, abnormal Df(Chr4:dre-mir-96,dre-mir-183)lri69/lri69 standard conditions Fig. 3 with image from Fogerty et al., 2019
neuromast has fewer parts of type neuromast hair cell, abnormal Df(Chr4:dre-mir-96,dre-mir-183)lri69/lri69 chemical treatment by environment: gentamycin Fig. 7 with image from Fogerty et al., 2019
retina dre-mir-183 expression absent, abnormal Df(Chr4:dre-mir-96,dre-mir-183)lri69/lri69 standard conditions Fig. 3 with image from Fogerty et al., 2019
optomotor response increased occurrence, abnormal Df(Chr4:dre-mir-96,dre-mir-183)lri69/lri69 standard conditions Fig. 5 with image from Fogerty et al., 2019
neuromast hair cell detection of mechanical stimulus involved in sensory perception of sound decreased process quality, abnormal Df(Chr4:dre-mir-96,dre-mir-183)lri69/lri69 standard conditions Fig. 8 with image from Fogerty et al., 2019
neuromast has fewer parts of type neuromast hair cell stereocilium bundle, abnormal Df(Chr4:dre-mir-96,dre-mir-183)lri69/lri69 standard conditions Fig. 8 with image from Fogerty et al., 2019
neuromast hair cell stereocilium bundle malformed, abnormal Df(Chr4:dre-mir-96,dre-mir-183)lri69/lri69 standard conditions Fig. 7 with image from Fogerty et al., 2019
swimming decreased process quality, abnormal Df(Chr4:dre-mir-96,dre-mir-183)lri69/lri69 standard conditions Fig. 7 with image from Fogerty et al., 2019
neuromast hair cell stereocilium maintenance decreased process quality, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 7 with image from Fogerty et al., 2019
retina dre-mir-96 expression absent, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 3 with image from Fogerty et al., 2019
whole organism semi-viable, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 6 with image from Fogerty et al., 2019
neuromast has fewer parts of type neuromast hair cell, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 chemical treatment by environment: gentamycin Fig. 7 with image from Fogerty et al., 2019
retinal cone cell photoreceptor inner segment decreased length, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 4 with image from Fogerty et al., 2019
retina dre-mir-183 expression absent, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 3 with image from Fogerty et al., 2019
retina dre-mir-182 expression decreased amount, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 3 with image from Fogerty et al., 2019
neuromast hair cell detection of mechanical stimulus involved in sensory perception of sound decreased process quality, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 8 with image from Fogerty et al., 2019
neuromast hair cell stereocilium bundle malformed, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 7 with image from Fogerty et al., 2019
neuromast has fewer parts of type neuromast hair cell stereocilium bundle, abnormal Df(Chr4:dre-mir183,dre-mir096,dre-mir-182)lri78/lri78 standard conditions Fig. 8 with image from Fogerty et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.