CRISPR

CRISPR1-fsd1

ID

ZDB-CRISPR-190708-1

Name

CRISPR1-fsd1

Previous Names

None

Target

fsd1 (1)

Sequence

5' - GGGCGCCTGCACCAAAGCCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ioz104	fsd1

Expression

Gene expression in Wild Types + CRISPR1-fsd1

Expressed Gene	Anatomy	Figures
myl7	heart tube	Fig. S3 from Tu et al., 2018

Phenotype

Phenotype resulting from CRISPR1-fsd1

Phenotype	Fish	Figures
determination of heart left/right asymmetry process quality, abnormal	AB + CRISPR1-fsd1	Fig. S3 from Tu et al., 2018
heart tube mislocalised, abnormal	AB + CRISPR1-fsd1	Fig. S3 from Tu et al., 2018
Kupffer's vesicle cilium decreased amount, abnormal	AB + CRISPR1-fsd1	Fig. 1 from Tu et al., 2018
whole organism increased curvature, abnormal	AB + CRISPR1-fsd1	Fig. S3 from Tu et al., 2018

Phenotype of all Fish created by or utilizing CRISPR1-fsd1

Phenotype	Fish	Conditions	Figures
whole organism hey2 expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 6 from Liu et al., 2019
whole organism runx1 expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 3 from Liu et al., 2019
whole organism her2 expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 6 from Liu et al., 2019
ventral wall of dorsal aorta gfi1aa expression decreased distribution, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 5 from Liu et al., 2019
hemopoiesis decreased occurrence, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 5 from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 3 from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 3 from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 3 from Liu et al., 2019
whole organism her5 expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 6 from Liu et al., 2019
caudal hematopoietic tissue gata1a expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 5 from Liu et al., 2019
thymus rag1 expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 5 from Liu et al., 2019
whole organism her1 expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 6 from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 3 from Liu et al., 2019
caudal hematopoietic tissue gata1a expression decreased distribution, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 5 from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 3 from Liu et al., 2019
ventral wall of dorsal aorta gfi1aa expression decreased amount, abnormal	fsd1^{ioz104/ioz104}	control	Fig. 5 from Liu et al., 2019
determination of heart left/right asymmetry process quality, abnormal	AB + CRISPR1-fsd1	standard conditions	Fig. S3 from Tu et al., 2018
heart tube mislocalised, abnormal	AB + CRISPR1-fsd1	standard conditions	Fig. S3 from Tu et al., 2018
Kupffer's vesicle cilium decreased amount, abnormal	AB + CRISPR1-fsd1	standard conditions	Fig. 1 from Tu et al., 2018
whole organism increased curvature, abnormal	AB + CRISPR1-fsd1	standard conditions	Fig. S3 from Tu et al., 2018

Citations